Environmental Free-Living Amoebae Isolated from Soil in Khon Kaen, Thailand, Antagonize Burkholderia pseudomallei


Noinarin, P.; Chareonsudjai, P.; Wangsomnuk, P.; Wongratanacheewin, S.; Chareonsudjai, S.

Plos One 11(11): E0167355-E0167355

2016


NlmCategory="UNASSIGNED">Presence of Burkholderia pseudomallei in soil and water is correlated with endemicity of melioidosis in Southeast Asia and northern Australia. Several biological and physico-chemical factors have been shown to influence persistence of B. pseudomallei in the environment of endemic areas. This study was the first to evaluate the interaction of B. pseudomallei with soil amoebae isolated from B. pseudomallei-positive soil site in Khon Kaen, Thailand. Four species of amoebae, Paravahlkampfia ustiana, Acanthamoeba sp., Naegleria pagei, and isolate A-ST39-E1, were isolated, cultured and identified based on morphology, movement and 18S rRNA gene sequence. Co-cultivation combined with a kanamycin-protection assay of B. pseudomallei with these amoebae at MOI 20 at 30°C were evaluated during 0-6 h using the plate count technique on Ashdown's agar. The fate of intracellular B. pseudomallei in these amoebae was also monitored by confocal laser scanning microscopy (CLSM) observation of the CellTracker™ Orange-B. pseudomallei stained cells. The results demonstrated the ability of P. ustiana, Acanthamoeba sp. and isolate A-ST39-E1 to graze B. pseudomallei. However, the number of internalized B. pseudomallei substantially decreased and the bacterial cells disappeared during the observation period, suggesting they had been digested. We found that B. pseudomallei promoted the growth of Acanthamoeba sp. and isolate A-ST39-E1 in co-cultures at MOI 100 at 30°C, 24 h. These findings indicated that P. ustiana, Acanthamoeba sp. and isolate A-ST39-E1 may prey upon B. pseudomallei rather than representing potential environmental reservoirs in which the bacteria can persist.

PLOS
ONE
CrossMark
RESEARCH
ARTICLE
Environmental
Free-Living
Amoebae
Isolated
from
Soil
in
Khon
Kaen,
Thailand,
Antagonize
Burkholderia
pseudomallei
Parumon
Noinarin'
'
4
,
Pisit
Chareonsudjai
2
'
4
'
5
,
Pinich
Wangsomnuk
3
,
Surasak
Wongratanacheewin'
Sorujsiri
Chareonsudjai
l
'
4
'
5*
1
Department
of
Microbiology,
Faculty
of
Medicine,
Khon Kaen
University,
Khon
Kaen,
Thailand,
2
Department
of
Environmental
Science,
Faculty
of
Science,
Khon Kaen
University,
Khon
Kaen,
Thailand,
3
Department
of
Biology,
Faculty
of
Science,
Khon
Kaen
University,
Khon
Kaen,
Thailand,
4
Melioidosis
Research
Center,
Khon
Kaen
University,
Khon
Kaen,
Thailand,
5
Biofilm
Research
Group,
Khon
Kaen
University,
Khon
Kaen,
Thailand
*
kku.ac.th
Abstract
Presence
of
Burkholderia
pseudomallei
in
soil
and
water
is
correlated
with
endemicity
of
melioidosis
in
Southeast
Asia
and
northern
Australia.
Several
biological
and
physico-
chemical
factors
have
been
shown
to
influence
persistence
of
B.
pseudomallei
in
the
envi-
ronment
of
endemic
areas.
This
study
was
the
first
to
evaluate
the
interaction
of
B.
pseudo-
mallei
with
soil
amoebae
isolated
from
B.
pseudomallei-positive
soil
site
in
Khon
Kaen,
Thailand.
Four
species
of
amoebae,
Paravahlkampfia
ustiana,
Acanthamoeba
sp.,
Nae-
gleria
pagei,
and
isolate
A-ST39-E1,
were
isolated,
cultured
and
identified
based
on
mor-
phology,
movement
and
18S
rRNA
gene
sequence.
Co-cultivation
combined
with
a
kanamycin-protection
assay
of
B.
pseudomallei
with
these
amoebae
at
MOI
20
at
30°C
were
evaluated
during
0-6
h
using
the
plate
count
technique
on
Ashdown's
agar.
The
fate
of
intracellular
B.
pseudomallei
in
these
amoebae
was
also
monitored
by
confocal
laser
scanning
microscopy
(CLSM)
observation
of
the
CellTrackerTM
Orange-B.
pseudomallei
stained
cells.
The
results
demonstrated
the
ability
of
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1
to
graze
B.
pseudomallei.
However,
the
number
of
internalized
B.
pseu-
domallei
substantially
decreased
and
the
bacterial
cells
disappeared
during
the
observa-
tion
period,
suggesting
they
had
been
digested.
We
found
that
B.
pseudomallei
promoted
the
growth
of
Acanthamoeba
sp.
and
isolate
A-ST39-E1
in
co-cultures
at
MOI
100
at
30°C,
24
h.
These
findings
indicated
that
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1
may
prey
upon
B.
pseudomallei
rather
than
representing
potential
environmental
reser-
voirs
in
which
the
bacteria
can
persist.
Introduction
The
soil-dwelling
bacterium,
Burkholderia
pseudomallei,
is
the
causative
agent
of
a
fatal
infec-
tious
disease,
melioidosis
that
is
endemic
particularly
in
Southeast
Asia
and
northern
Australia
G
OPEN
ACCESS
Citation:
Noinarin
P,
Chareonsudjai
P,
Wangsomnuk
P,
Wongratanacheewin
S,
Chareonsudjai
S
(2016)
Environmental
Free-Living
Amoebae
Isolated
from
Soil
in
Khon
Kaen,
Thailand,
Antagonize
Burkholderia
pseudomallei.
PLoS
ONE
11(11):
e0167355.
doi:10.1371/journal.
pone.0167355
Editor:
William
C.
Nierman,
J
Craig
Venter
Institute,
UNITED
STATES
Received:
July
9,
2016
Accepted:
November
11,
2016
Published:
November
29,
2016
Copyright
©
2016
Noinarin
et
al.
This
is
an
open
access
article
distributed
under
the
terms
of
the
Creative
Commons
Attribution
License,
which
permits
unrestricted
use,
distribution,
and
reproduction
in
any
medium,
provided
the
original
author
and
source
are
credited.
Data
Availability
Statement:
All
relevant
data
are
within
the
paper.
Funding:
This
work
was
supported
by
the
Office
of
the
Higher
Education
Commission,
Thailand.
Parumon
Noinarin
was
supported
by
CHE
Ph.D.
Scholarship
The
Office
of
the
Higher
Education
Commission,
Thailand.
The
funder
had
no
role
in
study
design,
data
collection
and
analysis,
decision
to
publish,
or
preparation
of
the
manuscript.
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
1
/
13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
Competing
Interests:
The
authors
have
declared
that
no
competing
interests
exist.
[1-3].
Physico-chemical
parameters
that
facilitate
persistence
of
B.
pseudomallei
in
the
envi-
ronment
include
slightly
acidic
soil,
a
moisture
content
>10%,
and
relatively
high
chemical
oxygen
demand
and
total
nitrogen
[4,
5].
Moreover,
soil
microcosms
with
low
salinity
and
iron
were
found
to
alter
the
bacterial
morphology
from
a
rod-like
to
a
coccoid
form,
suggest-
ing
that
such
conditions
are
advantageous
for
its
persistence
in
the
environment
and
may
increase
the
risk
of
transmission
to
humans
[
].
Several
biological
factors
have
also
been
dem-
onstrated
to
influence
the
survival
of
B.
pseudomallei.
Kaestli
and
colleagues
noted
its
presence
in
native
and
exotic
grasses
in
northern
Australia,
suggesting
a
potential
for
spread
of
B.
pseu-
domallei
by
grazing
animals
[7].
In
addition,
the
association
of
B.
pseudomallei
with
germinat-
ing
spores
of
the
arbuscular
mycorrhizal
fungus
Gigaspora
decipiens
emphasized
the
ability
of
the
bacterium
to
interact
with
various
eukaryotic
cells
[
].
Negative
interactions
with
a
closely
related
species,
Burkholderia
ubonensis
in
melioidosis-endemic
areas
have
been
demonstrated.
The
inactivation
was
caused
by
a
pepsin-sensitive
peptide
moiety
consistent
with
a
bacterio-
cin-like
compound,
suggesting
the
application
for
biocontrol
of
this
pathogen
[9].
Another
related
species,
B.
multivorans,
also
antagonizes
the
growth
of
B.
pseudomallei
in
soil
[10].
The
presence
of
B.
pseudomallei
in
an
agricultural
crop
soil
was
inversely
related
to
the
pres-
ence
of
antagonistic
strains
that
can
survive
in
a
broader
range
of
pH,
temperatures
and
salt
concentrations.
Free-living
amoebae
are
also
known
to
have
diverse
interactions
with
environmental
bac-
teria.
Such
amoebae
use
bacteria
as
food
sources
and
may
be
therefore
considered
to
control
microbial
communities
[11].
However,
they
may
also
act
as
"Trojan
horses",
providing
shel-
ter
and
leading
to
long-term
infra-amoeba
survival
of
bacteria,
thereby
aiding
bacterial
sur-
vival
and
dispersal
[12,
13].
Strategies
to
prevent
engulfment
and
survive,
or
to
replicate
within
protozoa,
could
have
evolved
among
bacteria
[
].
This
phenomenon
offers
not
only
a
protective
reservoir
but
could
also
select
for
virulence
behaviors
that
allow
intracellular
growth
of
bacteria,
facilitating
the
transmission
of
infectious
bacteria
from
the
environment
to
humans
[
].
Amoebae
in
the
genera
Acanthamoeba,
Dictyostelium,
Hartmannella
and
Naegleria
can
act
as
reservoirs
for
pathogenic
bacteria
[15,
16].
Legionella
pneumophila
is
the
most
acknowledged
intracellular
bacterium
harbored
within
free-living
amoebae
and
has
evolved
mechanisms
for
survival
in
eukaryotic
host
cells
[14].
Meanwhile,
the
endocyto-
sis
of
B.
pseudomallei
into
free-living
amoebae
belonging
to
the
genus
Acanthamoeba
recov-
ered
from
water
samples
in
Australia
suggested
the
possibility
of
environmental
survival
and
subsequent
human
exposure
[17].
Moreover,
B.
pickettii
[
Campylobacter
jejuni
[
Escherichia
coli
[20,
21],
Helicobacter
pylori
[22],
Listeria
monocytogenes
[23],
Mycobac-
terium
leprae
[24],
Shigella
dysenteriae
and
S.
sonnei
[25]
and
Vibrio
cholera
[26]
have
all
been
shown
to
have
interactions
with
amoebae.
However,
not
all
these
interactions
are
favorable
for
the
bacterium
since
M.
bovis
was
reported
to
be
inactivated
by
environmental
amoebae
[27].
To
the
best
of
our
knowledge,
there
is
only
limited
information
concerning
the
nature
of
any
interactions
between
free-living
amoebae
isolated
from
soil
and
B.
pseudomallei.
The
aim
of
our
study
was
to
investigate
such
interactions
using
free-living
amoebae
and
B.
pseudomallei
isolated
from
the
same
soil
site
in
Khon
Kaen
Province,
Thailand.
Isolated
amoebae
were
cul-
tured
and
maintained
in
the
laboratory
with
living
Escherichia
coli.
Based
on
morphology
and
18S
rRNA
gene
sequences,
at
least
four
species
of
amoebae
were
maintained
and
identified
as
Paravahlkampfia
ustiana,
Acanthamoeba
sp.,
Naegleria
pagei
and
isolate
A-ST39-E1.
A
co-cul-
tivation
technique,
combined
with
fluorescence
staining
and
plate-count
techniques,
revealed
a
negative
impact
of
these
amoebae
on
B.
pseudomallei.
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
2
/
13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
Materials
and
Methods
Amoeba
isolation
and
cultivation
Soil
amoebae
were
isolated
from
a
B.
pseudomallei-positive
soil
site,
site
39,
[28]
based
on
an
enrichment
method
with
slight
modification
[29]
with
the
permission
of
the
owner
of
the
land.
Briefly,
2
g
of
soil
was
placed
at
the
center
of
a
non-nutrient
agar
(1.5%
agar)
plate.
Then
2
mL
of
a
0.03%
tryptic
soy
broth
(TSB)
was
gently
dropped
on
the
soil
and
incubated
at
30°C
(represent
the
average
temperature
of
Khon
Kaen
province,
Thailand)
for
2
days
in
the
dark,
tightly
wrapped
to
keep
the
humidity
high.
Soil
amoebae
were
then
detached
from
the
agar
surface
by
cooling
the
plate
to
4°C
for
at
least
3
min
and
flushing
with
0.03%
TSB.
After
leaving
the
sediment
to
settle
for
3
min,
the
upper
layer
of
the
supernatant
containing
amoebae
was
transferred
and
diluted
with
0.03%
TSB
for
a
limiting
dilution
in
a
96-well
tissue
culture
plate
(Costar,
Corning,
NY,
USA)
and
incubated
at
30°C
in
darkness.
Daily
observation
under
an
inverted
microscope
(Nikon
Eclipse
TS100,
Japan)
was
used
to
look
for
wells
containing
single
amoebic
morphotypes.
A
single
amoebic
cell
in
each
well
was
maintained
by
daily
replacement
with
fresh
0.03%
TSB
daily
until
cells
were
40-50%
confluent.
The
amoebic
cultures
were
thereafter
maintained
under
monoxenic
conditions
with
E.
coli
SM-10
as
a
food
source
in
24-well
plates
(Costar,
Corning,
NY,
USA)
at
30°C
until
cells
were
approximately
70%
conflu-
ent.
Trophozoites
were
gently
washed
3
times
with
100
111,
of
Page's
Amoebic
Saline
(PAS)
(0.012%
NaCl,
0.0004%
MgSO
4
.7H
2
0,
0.0004%
CaCl
2
•2H
2
0,
0.0142%
Na
2
HPO
4
and
0.0136%
KH
2
PO
4
)
[30]
to
remove
most
nutrients
and
resuspended
in
4°C-PAS
before
enumeration
using
a
hemocytometer.
For
the
co-cultivation
experiment
with
the
kanamycin-protection
assay,
amoeba
trophozo-
ites
were
pre-treated
with
a
gradually
increasing
series
of
kanamycin
concentrations
(30-
300
µg/mL)
by
changing
PAS
with
kanamycin
daily
for
10
days.
The
treated
amoeba
trophozo-
ites
were
therefore
made
tolerant
to
300
µg/mL
kanamycin.
Morphological
analysis
Bright-field
microscopy.
Amoebae
(approximately
100
cells/10
µI,
PAS)
were
fixed
with
10
111,
of
2.5%
(v/v)
glutaraldehyde
(EM
grade;
Electron
Microscopy
Sciences,
Hatfield,
PA)
for
15
min
and
stained
with
either
10
µI,
of
0.4%
(w/v)
trypan
blue
or
0.1%
(w/v)
crystal
violet
for
30
sec.
After
5
washes
with
PAS,
the
amoebae
were
post-fixed
with
10
µI,
of
1.25%
(v/v)
glutar-
aldehyde
and
examined
under
a
bright
field
microscope
(Nikon,
Eclipse
Ni,
Japan)
at
1000x
magnification.
Examination
of
cyst
morphology
was
performed
after
a
culture
had
been
left
in
PAS
at
room
temperature
for
7
days
in
a
tightly
closed
microtube
to
allow
starvation
and
oxy-
gen
limitation.
The
images
were
processed
using
the
Axio
Vision
software.
DNA
extraction
and
PCR.
Genomic
DNA
was
extracted
from
each
amoeba
culture
using
a
QIAamp
DNA
Mini
Kit
(Qiagen,
Germany).
The
18S
rRNA
gene
was
amplified
by
PCR
using
5
pairs
of
specific
primers
(Table
1)
to
achieve coverage
of
the
full
length
of
the
gene.
Each
PCR
reaction
contained
30
ng
of
template
DNA,
10
mM
of
each
primer,
1.25
units
of
Taq
DNA
polymerase
(RBC,
Bioscience,
Taipei,
Taiwan),
10x
Taq
buffer
with
15
mM
MgCl
2
,
100
µM
of
each
deoxynucleotide
in
a
total
volume
of
25
µL.
All
PCR
reactions
used
the
same
cycling
conditions:
incubation
at
95°C
for
5
min,
followed
by
35
cycles
of
95°C
for
30
seconds,
52°C
for
30
sec
and
72°C
for
40
sec
and
a
final
extension
at
72°C
for
6
min
(ABI
thermocycler,
Applied
Biosystems,
USA).
Thereafter,
the
PCR
products
were
gel-purified
using
the
HiYield
gel/PCR
DNA
fragments
extraction
kit
(RBC,
Bioscience,
Taipei,
Taiwan).
The
purified
ampli-
cons
were
sequenced
(Bioneer
Corporation,
Daejeon,
South
Korea)
before
assembly
using
the
BioEdit
alignment
program
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html)
.
Sequences
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
3
/
13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
Table
1.
Specific
primers
for
the
18s
rRNA
gene
of
amoebae.
Primer
name
Nucleotide
sequence
(5'
to
3')
18s-Vahl-1-F
GATCCTGCCAGTAGTCATATGC
18s-Vahl-1-R
CGCTATGTCTTGTCACTACCTC
18s-Vahl-II-F
TTCTGGAGAGAGAGCCTGAG
18s-Vahl-II-R
CTATTGGAGCTGGAATTACCG
18s-Vahl-III-F
ATTGGAGGACAAGTCTGGTG
18s-Vahl-III-R
GACTACGACGGTATCTGATC
18s-Vahl-IV-F
CAGGGACGAAAGTTAAGGGATC
18s-Vahl-IV-R
GCATCACAGACCTGTTATTGCC
18s-Vahl-V-F
ATTGGGTGGTGGTGCATGG
18s-Vahl-V-R
CTAGGAATTCCTCGTTCACG
doi:10.1371/journal.pone.0167355.t001
were
compared
with
existing
18S
rRNA
sequences
on
GenBank
using
BLAST
searches
(http://
www.ncbi.nlm.nih.gov/blast/Blast.cgi).
Bacterial
strains
and
growth
conditions
B.
pseudomallei
isolated
from
the
positive
soil
site,
Ban
Kai
Na
in
Nam
Phong
district,
Khon
Kaen,
Thailand
[5,
6]
was
used
throughout
this
study.
B.
pseudomallei
was
previously
isolated
and
identified
[5,
31].
In
brief,
100
g
soil
was
vigorously
mixed
with
100
mL
distilled
water
before
left
for
30
min
to
allow
sedimentation.
Thereafter,
500
µL
of
the
supernatant
was
plated
onto
modified
Ashdown's
agar
and
incubated
at
37°C
and
visually
inspected
daily
for
4
to
7
days.
B.
pseudomallei-suspected
colonies
(wrinkled
or
smooth
with
purple-pink
color)
were
verified
by
triple
sugar
iron
(TSI),
augmentin/colistin
susceptibility,
assimilation
of
L-arabi-
nose
test,
latex
agglutination
[32]
and
PCR
using
the
specific
primers
(BpTT4176F
and
BpTT4290R)
[33].
B.
pseudomallei
was
stored
in
Luria
Bertani
(LB)
with
45%
glycerol
at
-80°C.
Bacteria
from
frozen
stocks
was
streaked
on
an
Ashdown's
agar
plate
and
incubated
at
37°C
for
48
h.
A
single
colony
of
B.
pseudomallei
was
thereafter
cultured
in
3
mL
LB
broth
at
37°C,
200
rpm,
16
h
before
being
harvested
and
washed
twice
at
8,000
xg,
30
sec
and
resuspended
in
PAS
to
10
7
cells/mL
for
co-culture
investigation.
Nonpathogenic
E.
coli
strain
SM-10
was
grown
in
LB
broth
at
37°C,
200
rpm
for
16
h
and
used
as
a
food
source
(MOI
100)
to
maintain
amoeba
species
at
the
trophozoite
stage
during
cultivation.
Co-culture
of
amoeba
trophozoites
and
B.
pseudomallei
To
investigate
intracellular
viability
of
B.
pseudomallei
in
amoebae,
trophozoites
of
each
amoeba
species
were
harvested
by
centrifugation
at
500xg
for
3
min,
washed
3
times
and
resuspended
in
PAS
in
a
24-well
plate
(5x10
3
cells/well)
before
being
allowed
to
form
a
mono-
layer
for
15
min.
Subsequently,
B.
pseudomallei
cells
in
PAS
at
the
optimal
MOI
20
were
added
to
each
well
containing
a
monolayer
of
amoebae
and
incubated
for
1
h
at
30°C.
Extracellular
B.
pseudomallei
were
removed,
first
by
washing
with
PAS
3
times
then
by
the
kanamycin
pro-
tection
assay
at
a
final
concentration
of
300
µg/mL
kanamycin
for
30
min
to
eliminate
extracel-
lular
B.
pseudomallei.
The
complete
elimination
of
extracellular
B.
pseudomallei
was
checked
by
plate
count
technique.
Afterwards,
the
culture
solution
was
aspirated
by
pipette
and
the
remaining
monolayer
was
washed
once
with
PAS
and
further
incubated
in
PAS
at
30°C
for
another
3
and
6
h.
The
monolayers
of
amoebae
were
then
lysed
with
0.1%
triton-X100
for
20
sec
to
release
internalized
B.
pseudomallei
[34].
Colony
forming
units
(CFUs)
of
B.
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
4
/
13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
pseudomallei
were
enumerated
by
plating
on
Ashdown's
agar,
the
selective
media
for
B.
pseu-
domallei
and
incubated
at
37°C
for
2
days
and
reported
as
log10
CFU/mL.
All
experiments
were
performed
in
duplicates,
each
of
three
independent
experiments.
To
examine
whether
B.
pseudomallei
could
promote
the
growth
of
the
amoebae,
1
mL
of
approximately
10
4
/mL
amoeba
trophozoites
in
PAS
in
a
1.5
mL-microtube
were
co-cultured
with
B.
pseudomallei
at
MOI
100
and
incubated
at
30°C
for
0,
6,
12,
18
and
24
h.
In
parallel,
positive
and
negative
controls
consisted
of
amoebae
fed
with
E.
coli
(MOI
100)
and
amoebae
with
no
E.
coli,
respectively.
The
amoeba
cells
at
each
time
point
were
taken
and
fixed
with
a
final
concentration
of
1.25%
(v/v)
glutaraldehyde
before
being
counted
using
a
hemocytome-
ter.
Meanwhile,
the
population
of
amoebae
were
also
examined
and
photographed
under
a
Carl
Zeiss
upright
microscope
with
built-in
camera.
The
investigations
were
performed
in
duplicates
of
three
independent
experiments.
Monitoring
of
intracellular
B.
pseudomallei
using
a
confocal
laser
scanning
microscope
B.
pseudomallei
was
stained
with
CellTracker
Orange
CMTMR
(Invitrogen,
USA)
according
to
the
manufacturer's
instructions.
The
CellTracker
Orange-B.
pseudomallei
were
co-cultured
with
amoebae
at
MOI
20
at
30°C
for
1
h
followed
by
the
kanamycin
protection
assay
in
a
24-well
plate
and
further
incubated
for
3
and
6
h.
After
gently
washing
5
times
with
PAS,
10
[iL
of
the
amoebae
were
taken
and
dropped
on
to
a
coverslip.
Subsequently,
the
amoeba
cells
were
fixed
with
1.25%
(v/v)
glutaraldehyde
for
10
min
before
FITC-ConA
(Sigma,
USA)
at
50
[ig/
mL
final
concentration
was
applied
and
incubated
at
room
temperature
for
20
min.
The
cover
slip
was
thereafter
placed
on
a
glass
slide.
The
internalized
B.
pseudomallei
were
detected
by
fluorescence
under
a
LSM
800
confocal
laser
scanning
microscope
(CLSM)
(Zeiss,
Germany).
The
CellTracker
Orange-B.
pseudomallei
and
the
FITC-ConA-amoeba
stained
cells
were
excited
with
516
and
488
nm
lasers,
respectively.
Image
processing
was
done
using
ZEN
software.
Statistical
analysis
The
results
of
log
io CFU
and
numbers
of
amoebae
are
reported
as
the
mean
±
standard
devia-
tion
(SD)
from
duplicates
of
three
independent
experiments.
The
numbers
of
bacteria
and
amoebae
at
different
time
intervals
were
statistically
analyzed
using
ANOVA
(analysis
of
vari-
ance).
Statistical
analyses
were
performed
using
GraphPad
Prism
software,
p
values
less
than
0.05
were
considered
to
indicate
statistical
significance.
Results
Amoeba
species
identification
Amoebae
from
the
B.
pseudomallei-positive
soil
sample
were
isolated
and
maintained
as
monoxenic
cultures
with
E.
coli
as
their
food
source.
The
three
amoeba
species
were
Para-
vahlkampfia
ustiana,
Acanthamoeba
sp.,
and
Naegleria
pagei,
identified
according
to
their
morphologies
and
18S
rRNA
gene
sequences.
However,
the
isolate
A-ST39-E1
could
not
be
identified
because
the
18S
rRNA
did
not
match
any
nucleotide
sequences
in
the
database.
The
trophozoite
of
P.
ustiana
was
elongated
and
cylindrical
(Fig
1A).
Cells
exhibited
erup-
tive
locomotion
and
possessed
a
single
vesicular
nucleus.
A
rhizoid-like
element
was
present
on
a
part
of
the
cell
terminal
opposite
the
direction
of
movement.
The
trophozoite
was
unable
to
transform
into
a
flagellate
state.
Cysts
were
spherical,
approximately
8-10
[un
in
diameter
and
without
pores
in
the
walls
(Fig
1B).
The
1,692
bp
18S
rRNA
gene
sequence
is
deposited
in
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
5
/
13
10µm
N
Uf
10µm
Fv
Ac
ate
N
10µm
,
u
"
s
-
\
'
S
0
10µm
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
C
D
G
H
Fig
1.
Bright
field
microscopic
images
demonstrate
trophozoite
and
cyst
morphology
(A
and
B)
Paravahltrampfia
ustiana,
(C
and
D)
Acanthamoeba
sp.,
(E
and
F)
Naegleria
pagei
and
(G
and
H)
isolate
A-ST39-E1.
P.
ustiana,
N.
pagei
and
isolate
A-ST39-E1
were
stained
with
trypan
blue
while
Acanthamoeba
sp.
was
stained
with
crystal
violet.
The
letter
in
images
indicate
the
following:
Uf
=
Uroidal
filaments,
N
=
Nucleus,
Ac
=
Acanthopodia,
Cv
=
Contractile
vacuole,
Fv
=
Food
vacuole,
0
=
Outer-cyst
wall,
I
=
Inner-cyst
wall,
F
=
Flagella,
S
=
Sub-pseudopodium
and
U
=
Uroid.
A
B
E
F
doi:10.1371/journal.pone.0167355.g001
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
6
/
13
A
°A)
In
trace
llu
lar
Bp.
su
rv
iv
a
l
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
the
GenBank
database
(accession
number:
KX068999).
The
BLAST
result
demonstrated
99%
similarity
to
P.
ustiana
(GenBank
accession
number:
AJ224890).
Acanthamoeba
sp.
exhibited
an
amoeboid
form
without
flagellate
state,
and
possessed
spine-like
structures
(acanthopodia)
on
its
surface
(Fig
1C).
The
cyst
was
star-like
with
a
dou-
ble-layered
wall
which
is
a
typical
character
of
the
genus
Acanthamoeba
(Fig
1D).
The
1,829
bp
of
the
18S
rRNA
sequence
(GenBank
accession
number:
KX069000)
revealed
the
highest
similarity
(99%
at
the
nucleotide
level)
with
Acanthamoeba
sp.
(GenBank
accession
number:
AF333608).
Naegleria
pagei
was
identified
according
to
the
biflagellate
and
amoeboid
stages
in
its
life
cycle
(Fig
1E).
The
amoeboid
form
was
typically
elongated
and
possessed
laterally-
branched
pseudopodia.
The
cyst
was
spherical,
approximately
3-5
µm
in
diameter,
and
con-
tained
a
single
granule
(Fig
1F).
The
1,822
bp
18S
rRNA
gene
sequence
(GenBank
accession
number:
KX069001)
shared
99%
similarity
with
N.
pagei
(GenBank
accession
number:
DQ768721).
Isolate
A-ST39-El;
an
amoeboid
organism,
exhibited
both
trophozoite
and
cyst
stages
in
its
life
cycle.
The
trophozoite
was
uninucleate
with
elongated
sub-pseudopodia
and
a
bulbous
uroid
(Fig
1G).
Notably,
cell
shape
and
size
fluctuated
among
members
of
a
single
clone.
The
cyst
was
spherical
with
an
average
diameter
of
10
µm
(Fig
1H).
The
582
bp
partial
18S
rRNA
gene
sequence
(GenBank
accession
number:
KX069002)
shared
no
significant
similarity
with
any
amoeba
species
deposited
in
the
GenBank
database.
Paravahlkampfia
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1
engulfed
and
digested
B.
pseudomallei
cells
We
first
investigated
whether
P.
ustiana,
Acanthamoeba
sp.,
N.
pagei
and
isolate
A-ST39-E1
could
engulf
and
have
an
impact
on
the
survival
of
internalized
B.
pseudomallei
by
co-cultiva-
tion
for
1
h,
followed
by
the
kanamycin
protection
assay
to
kill
extracellular
bacteria
(consid-
ered
as
0
h).
Meanwhile,
we
also
determined
that
kanamycin
at
300
[ig/mL
could
kill
100%
of
B.
pseudomallei
using
bacterial
plate
count
(data
not
shown).
Quantification
of
colony
forming
units
(CFUs)
of
the
internalized
B.
pseudomallei
indicated
the
ability
of
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1
to
engulf
B.
pseudomallei
(Figs
and
3).
On
the
other
hand,
N.
pagei
could
not
internalize
B.
pseudomallei
(data
not
shown).
The
percentages
of
B.
pseudomallei
surviving
inside
the
amoebae
at
0
h
(at
the
start
of
B
C
60-
7
60
7
60-
r
40-
au
6.
40-
M
R
20-
1
;
20
-
11
20
lC
O
0
0
3
6
3
3
Time
(h)
Time
(II)
Time
(h)
Fig
2.
Intracellular
survival
through
time
of
B.
pseudomallei
in
P.
ustiana
(A),
Acanthamoeba
sp.
(B)
and
isolate
A-ST39-E1
(C).
Time
zero
represents
3
hours
after
B.
pseudomallei
feeding.
Bars
represent
the
standard
errors
of
the
means
of
duplicate,
three
times
independent
experiments,
*
p<
0.0001
using
ANOVA.
doi:10.1371/journalpone.0167355.g002
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
7
/
13
Time
(h)
Acan
t
hamoe
ba
sp.
A-
S
T39-
E
1
iso
la
te
C
F
I
5
pm
1-1
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
0
3
6
A
D
G
r
r
B
E
H
Fig
3.
B.
pseudomallei
is
internalized
into
amoebae
but
could
not
resist
digestion.
CLSM
micrographs
show
the
internalized
B.
pseudomallei
in
P.
ustiana
(A-C),
Acanthamoeba
sp.
(D-F)
and
isolate
A-ST39-E1
(G-1)
at
0,
3
and
6
h
after
kanamycin
treatment.
Orange
fluorescence
represents
CellTrackerTM
Orange-B.
pseudomallei
and
green
fluorescence
indicates
the
amoebae
stained
with
FITC-ConA
for
visualization.
doi:10.1371/journalpone.0167355.g003
the
kanamycin
protection
assay)
compared
to
the
number
inoculated
were
44.17,
52.55
and
44.13
in
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1,
respectively
(Fig
2).
In
P.
usti-
ana,
this
had
dramatically
decreased
to
zero
at
3
h
(p
<
0.0001)
(Fig
2A).
In
Acanthamoeba
sp.
and
isolate
A-ST39-E1,
a
less
dramatic
decrease
occurred
by
3
h
(to
42.97%
and
28.71%,
respectively)
(p
<
0.0001)
but
no
living
B.
pseudomallei
could
be
detected
inside
these
amoebae
at
6
h
(Fig
2B
and
2C).
CLSM
images
revealed
that
the
CellTracker
Orange-B.
pseudomallei
were
localized
intracellularly
in
vacuoles
of
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1
at
0
h
after
kanamycin
treatment
(Fig
3A,
3D
and
3G).
Subsequently,
the
internalized
B.
pseudomallei
disappeared
within
P.
ustiana
at
3
and
6
h
(Fig
3B
and
3C).
Reductions
in
numbers
of
B.
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
8
/
13
Amoe
a
lone
Amoe
+
E.
co
li
Amoe
+
Bp.
c.
8
8
O
'
.
s
s
3.
1
mm
0:5
mm
(0)
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
A
7
4
i4
Amoe
+
Bp.
-
Amoe
+
Bp
3
-
Amoe
+
E.coli
x
3
-
Amoe
+
E.coli
-
Amoe
alone
-
Amoe
alone
1
-<t
0
o
11
6
12
18
24
311
6
12
IN
24
30
Time
00
Time
(11)
B
D
Time
(h)
11
6
12
18
24
Time
(h)
0
6
12
18
I
L
24
Fig
4.
Numbers
of
Acanthamoeba
sp.
and
isolate
A-ST39-E1
over
time
(A-B
and
C-D
respectively)
after
feeding
with
B.
pseudomallei
(A)
or
E.
colt
(positive
control)
(M)
or
deprived
of
bacteria
as
a
negative
control
NO.
Graphs
and
figures
show
no
significant
differences
between
amoebae
fed
on
B.
pseudomallei
and
E.
coli.
However,
numbers
of
amoebae
in
the
negative
control
group
were
significantly
lower
than
in
the
pother
groups
(p
<
0.0001).
Data
are
mean
±
SD
from
duplicates
of
the
three
independent
experiments.
doi:10.1371/journal.pone.0167355.g004
pseudomallei
in
the
cytoplasm
of
Acanthamoeba
sp.
and
isolate
A-ST39-E1
were
observed
at
3
h
(Fig
3E
and
3H)
and
none
could
be
detected
at
6
h
(Fig
3F
and
31).
These
results
suggested
that
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-E1,
cultured
from
a
B.
pseudomallei-positive
soil
site,
could
internalize
and
digest
B.
pseudomallei.
During
the
experimental
period,
all
amoeba
cells
retained
trophozoite
appearance:
no
evidence
of
cyst
formation
was
seen.
Burkholderia
pseudomallei
facilitated
growth
of
Acanthamoeba
sp.
and
isolate
A-ST39-E1
We
further
observed
the
numbers
of
Acanthamoeba
sp.
and
isolate
A-ST39-E1
co-cultivated
with
either
B.
pseudomallei
or
E.
coli
at
MOI
100
at
30°C
by
direct
counting
over
a
24
h
period.
Controls
were
amoebae
cultivated
without
bacterial
cells.
The
results
demonstrated
that
the
numbers
of
both
Acanthamoeba
sp.
and
isolate
A-ST39-E1
increased
with
time
when
co-cul-
tured
with
B.
pseudomallei
to
an
extent
comparable
to
those
co-cultured
with
E.
coli,
and
sig-
nificantly
higher
number
than
the
solo
amoebae
(p
<
0.0001)
(Fig
4A
and
4C).
Densities
were
directly
observed
under
a
light
microscope
(Fig
4B
and
4D).
Discussion
To
the
best
of
our
knowledge,
this
is
the
first
time
that
interactions
have
been
demonstrated
between
B.
pseudomallei
and
free-living
amoebae
isolated
from
the
same
soil
site
of
the
melioi-
dosis
endemic
zone.
Four
species
of
amoebae,
P.
ustiana,
Acanthamoeba
sp.,
N.
pagei
and
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
9
/
13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
isolate
A-ST39-E1
were
taken
into
monoxenic
culture
and
supplied
with
living
E.
coli
as
a
food
source.
Our
findings,
based
on
a
plate
count
technique
and
confocal
microscopy,
revealed
that
B.
pseudomallei
could
not
survive
predation
by
P.
ustiana,
Acanthamoeba
sp.
and
isolate
A-ST39-El.
Additionally,
amoebae
could
survive
and
prosper
when
co-cultured
with
B.
pseu-
domallei.
Our
findings
indicate
that
these
three
species
of
amoebae
can
internalize
and
digest
B.
pseudomallei
under
the
experimental
conditions
used
and
therefore
do
not
act
as
hosts
or
reservoirs
for
the
bacterium.
The
ability
of
environmental
amoebae
to
graze
B.
pseudomallei
was
previously
established
by
Inglis
et
al.
[17].
They
demonstrated
that
three
water-isolated
Acanthamoeba
species,
A.
astronyxis,
A.
castellani,
and
A.
polyphaga,
could
endocytose
B.
pseudomallei.
Our
study
has
shown
that
not
only
Acanthamoeba
species
can
graze
B.
pseudomallei
but
also
at
least
another
two
taxa
of
soil
amoebae,
P.
ustiana
and
isolate
A-ST39-E
1.
A
wide
spectrum
of
interactions
between
bacteria
and
environmental
protozoa
has
been
demonstrated.
Not
all
bacteria
are
digested
by
protozoa
grazing
on
them.
Indeed,
some
patho-
genic
bacteria
evade
digestion
and
can
persist
in
the
environment
within
amoebae
[13,
35].
Some
remarkable
examples
of
bacterial
survival
within
amoebae
have
been
demonstrated
in
recent
decades,
including
Legionella
pneumophila
and
related
species,
Vibrio
cholerae,
Helico-
bacter
pylori,
Mycobacterium
spp.,
Listeria
monocytogenes,
Escherichia
coli
0157
and
Pseudo-
monas
aeruginosa
[
].
Amoebae
not
only
provide
an
ecological
niche
for
those
bacteria
to
persist
in
the
environment
but
also
enhance
pathogenicity,
rendering
them
of
public
health
concern
[14,
36,
37].
Our
findings
are
consistent
with
Huws
and
colleagues
[38],
who
demonstrated
predation
effects
of
some
common
pathogenic
bacteria,
including
Bacillus
cereus,
Enterococcus
faecalis,
Enteropathogenic
E.
coli
(EPEC),
Salmonella
enterica
serovar
Typhimurium
by
the
environ-
mental
amoeba,
A.
polyphaga.
However,
Listeria
monocytogenes
and
methicillin-sensitive
Staphylococcus
aureus
(MSSA)
were
not
internalized
into
A.
polyphaga.
Moreover,
Akya
and
colleagues
[ ]
demonstrated
the
death
of
L.
monocytogenes
cells
phagocytosed
by
A.
polyphaga
AC012
trophozoites
within
a
few
hours
post-phagocytosis,
whereas,
S.
enterica
serovar
Typhi-
murium
C5
cells,
used
as
controls,
were
able
to
survive
and
multiply
within
A.
polyphaga
trophozoites.
Naturally
infected
Acanthamoeba
and
Naegleria,
common
inhabitants
of
soil
and
water
that
act
as
evolutionary
incubators
for
L.
pneumophila,
have
correlated
with
outbreaks
of
legionel-
losis
[
,
].
However, permissive
behaviors
of
amoebae
towards
L.
pneumophila
can
vary.
Dey
and
colleagues
[ ]
demonstrated
that
Willaertia
magna
c2c
inhibited
the
growth
of
one
strain
of
Legionella
but not
of
others
belonging
to
the
same
serogroup.
Conversely,
different
L.
pneumophila
strains
inhibited
cell
growth
and
induced
cell
death
in
A.
castellanii,
Hartman-
nella
vermiformis
and
W.
magna
Z503
within
3-4
days
while
W.
magna
c2c
strain
remained
unaffected
even
up
to
7
days.
The
inability
of
N.
pagei
to
graze
B.
pseudomallei
in
this
study
reinforces
the
food
selection
behavior
previously
verified
by
Xinyao
and
colleagues
[43].
They
demonstrated
that
Naegleria
sp.
strain
W2
could
consume
some
filamentous
cyanobacteria
(e.g.,
Anabaena,
Cylindrospermum,
Gloeotrichia,
and
Phormidium)
but not
Oscillatoria
and
Aphanizomenon.
We
are
aware
that
our
study
may
not
provide
a
complete
insight
into
the
interaction
of
B.
pseudomallei
with
protozoa
in
the
same
environmental
niche.
We
examined
the
interaction
between
B.
pseudomallei
and
the
4
amoeba
species
that
could
be
handled
in
our
laboratory.
Our
experimental
scenarios
may
not
represent
the
real
ecological
relationships
of
B.
pseudo-
mallei
in
the
environment.
It
is
likely
that
the
situation
in
natural
soil
is
more
complicated,
since
a
wide
variety
of
microorganisms
is
present.
Furthermore,
the
physico-chemical
nature
of
soil
may
be
involved
in
the
interactions
between
protozoan
grazers
and
their
prey
[44,
45].
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
10/
13
(0)
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
In
summary,
our
work
has
added
more
information
regarding
the
environmental
life-style
of
B.
pseudomallei.
Three
of
the
four
species
of
amoebae
isolated
in
this
study
could
internalize
and
subsequently
digest
B.
pseudomallei.
The
remaining
amoeba
species
had
no
interaction
with
B.
pseudomallei.
Bacteria
and
amoebae
residing
in
the
same
ecosystem
near
Khon
Kaen,
Thailand,
have
a
predator-prey
relationship.
Clearly,
not
all
amoeba
species
can
facilitate
the
persistence
and
dispersal
of
a
particular
bacterial
pathogen
in
the
environment.
Acknowledgments
This
work
was
supported
by
the
Office
of
the
Higher
Education
Commission.
Parumon
Noi-
narin
was
supported
by
CHE
Ph.D.
Scholarship.
We
would
like
to
acknowledge
Prof.
David
Blair
for
editing
the
manuscript
via
the
Publication
Clinic
of
KKU,
Thailand.
Author
Contributions
Conceptualization:
SC
PC.
Formal
analysis:
SC
PN.
Funding
acquisition:
SC
SW.
Investigation:
SC
PN
PC
PW.
Methodology:
SC
PN
PC.
Project
administration:
SC
PC.
Resources:
SC.
Supervision:
SC
PC.
Validation:
SC
PN.
Visualization:
PN.
Writing
-
original
draft:
SC
PN.
Writing
-
review
&
editing:
SC
PN
PC.
References
1.
Cheng
AC,
Currie
BJ.
Melioidosis:
epidemiology,
pathophysiology,
and
management.
Clin
Microbiol
Rev.
2005;
18(2):383-416.
doi:
10.1128/CMR.18.2.383-416.2005
PMID:
15831829
2.
White
NJ.
Melioidosis.
Lancet.
2003;
361(9370):1715-22.
PMID:
12767750
3.
Wiersinga
WJ,
Currie
BJ,
Peacock
SJ.
Melioidosis.
N
Engl
J
Med.
2012;
367(11):1035-44.
Epub
2012/
09/14.
doi:
10.1056/NEJMra1204699
PMID:
22970946
4.
Palasatien
S,
Lertsirivorakul
R,
Royros
P,
Wongratanacheewin
S,
Sermswan
RW.
Soil
physicochemical
properties
related
to
the
presence
of
Burkholderia
pseudomallei.
Trans
R
Soc
Trop
Med
Hyg.
2008;
102
Suppl
1:S5-9.
5.
Wang-Ngarm
S,
Chareonsudjai
S,
Chareonsudjai
P.
Physicochemical
factors
affecting
the
growth
of
Burkholderia
pseudomallei
in
soil
microcosm.
Am
J
Trop
Med
Hyg.
2014;
90(3):480-5.
Epub
2014/01/
22.
doi:
10.4269/ajtmh.13-0446
PMID:
24445210
6.
Kamjumphol
W,
Chareonsudjai
P,
Taweechaisupapong
S,
Chareonsudjai
S.
Morphological
Alteration
and
Survival
of
Burkholderia
pseudomallei
in
Soil
Microcosms.
Am
J
Trop
Med
Hyg.
2015;
93(5):1058-
65.
Epub
2015/09/02.
doi:
10.4269/ajtmh.15-0177
PMID:
26324731
7.
Kaestli
M,
Schmid
M,
Mayo
M,
Rothballer
M,
Harrington
G,
Richardson
L,
et
al.
Out
of
the
ground:
aerial
and
exotic
habitats
of
the
melioidosis
bacterium
Burkholderia
pseudomallei
in
grasses
in
Australia.
Envi-
ron
Microbiol.
2012;
14(8):2058-70.
Epub
2011/12/20.
doi:
10.1111/j.1462-2920.2011.02671.x
PMID:
22176696
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
11/13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
8.
Levy
A,
Chang
BJ,
Abbott
LK,
Kuo
J,
Harnett
G,
Inglis
TJ.
Invasion
of
spores
of
the
arbuscular
mycor-
rhizal
fungus
Gigaspora
decipiens
by
Burkholderia
spp.
Appl
Environ
Microbiol.
2003;
69(10):6250-6.
Epub
2003/10/09.
doi:
10.1128/AEM.69.10.6250-6256.2003
PMID:
14532087
9.
Marshall
K,
Shakya
S,
Greenhill
AR,
Padill
G,
Baker
A,
Warner
JM.
Antibiosis
of
Burkholderia
ubonen-
sis
againist
Burkholderia
pseudomallei,
the
causative
agent
for
melioidosis.
Southeast
Asian
J
Trop
Med
Public
Health.
2010;
41(4):904-12.
Epub
2010/11/16.
PMID:
10.
Lin
HH,
Chen
YS,
Li
YC,
Tseng
IL,
Hsieh
TH,
Buu
LM,
et
al.
Burkholderia
multivorans
acts
as
an
antag-
onist
against
the
growth
of
Burkholderia
pseudomallei
in
soil.
Microbiol
Immunol.
2011;
55:616-24.
Epub
2011/07/15.
doi:
10.1111/j.1348-0421.2011.00365.x
PMID:
21752084
11.
Matz
C,
Kjelleberg
S.
Off
the
hook-how
bacteria
survive
protozoan
grazing.
Trends
Microbiol.
2005;
13-
(7):302-7.
doi:
10.1016/j.tim.2005.05.009
PMID:
15935676
12.
Greub,
Matthias
H,
Wagner
M.
Bacterial
Endosymbionts
of
Free-living
Amoebae1.
J
Eukaryot
Micro-
biol.
2004;
51(5):509-14.
PMID:
15537084
13.
Greub
G,
Raoult
D.
Microorganisms
resistant
to
free-living
amoebae.
Clin
Microbiol
Rev.
2004;
17
(2):413-33.
Epub
2004/04/16.
doi:
10.1128/CMR.17.2.413-433.2004
PMID:
15084508
14.
Molmeret
M,
Horn
M,
Wagner M,
Santic
M,
Kwaik
YA.
Amoebae
as
training
grounds
for
intracellular
bacterial
pathogens.
Appl
Environ
Microbiol.
2005;
71(1):20-8.
doi:
10.1128/AEM.71.1.20-28.2005
PMID:
15640165
15.
Thom
S,
Warhurst
D,
Drasar
BS.
Association
of
Vibrio
cholerae
with
fresh
water
amoebae.
J
Med
Micro-
biol.
1992;
36(5):303-6.
Epub
1992/05/01.
doi:
10.1099/00222615-36-5-303
PMID:
1588578
16.
Thomas
V,
McDonnell
G,
Denyer
SP,
Maillard
JY.
Free-living
amoebae
and
their
intracellular
patho-
genic
microorganisms:
risks
for
water
quality.
FEMS
Microbiol
Rev.
2010;
34(3):231-59.
doi:
10.11114.
1574-6976.2009.00190.x
PMID:
19744244
17.
Inglis
TJ,
Rigby
P,
Robertson
TA,
Dutton NS,
Henderson
M,
Chang
BJ.
Interaction
between
Burkhol-
deria
pseudomallei
and
Acanthamoeba
species
results
in
coiling
phagocytosis,
endamebic
bacterial
survival,
and
escape.
Infect
Immun.
2000;
68(3):1681-6.
PMID:
10678988
18.
Michel
R,
Hauroder
B.
Isolation
of
an
Acanthamoeba
strain
with
intracellular
Burkholderia
pickettii
infec-
tion.
Zentralbl
Bakteriol.
1997;
285(4):541-57.
Epub
1997/04/01.
PMID:
19.
Bui
XT,
Winding
A,
Qvortrup
K,
Wolff
A,
Bang
DD,
Creuzenet
C.
Survival
of
Campylobacter
jejuni
in
co-
culture
with
Acanthamoeba
castellanii:
role
of
amoeba-mediated
depletion
of
dissolved
oxygen.
Environ
Microbiol.
2012;
14(8):2034-47.
Epub
2011/12/20.
doi:
PMID:
22176643
20.
Matin
A,
Jung
SY.
Interaction
of
Escherichia
coli
K1
and
K5
with
Acanthamoeba
castellaniitrophozoites
and
cysts.
Korean
J
Parasitol.
2011;
49(4):349-56.
Epub
2012/02/23.
doi:
10.3347/kjp.2011.49.4.349
PM
ID:
22355201
21.
Chekabab
SM,
Daigle
F,
Charette
SJ,
Dozois
CM,
Harel
J.
Survival
of
enterohemorrhagic
Escherichia
coli
in
the
presence
of
Acanthamoeba
castellanii
and
its
dependence
on
Pho
regulon.
Microbiologyo-
pen.
2012;
1(4):427-37.
Epub
2012/12/13.
doi:
10.1002/mbo3.
PMID:
23233434
22.
Smith
CD,
Ashbolt
NJ.
The
fate
of
Helicobacter
pyloriphagocytized
by
Acanthamoeba
polyphaga
dem-
onstrated
by
fluorescent
in
situ
hybridization
and
quantitative
polymerization
chain
reaction
tests.
Curr
Microbiol.
2012;
65(6):805-12.
Epub
2012/09/25.
doi:
10.1007/s00284-012-0232-2
PMID: 23001424
23.
Zhou
X,
Elmose
J,
Call
DR.
Interactions
between
the
environmental
pathogen
Listeria
monocytogenes
and
a
free-living
protozoan (Acanthamoeba
castellanii).
Environ
Microbiol.
2007;
9(4):913-22.
Epub
2007/03/16.
doi:
10.1111/j.1462-2920.2006.01213.x
PMID:
17359263
24.
Wheat
WH,
Casali
AL,
Thomas
V,
Spencer
JS,
Lahiri
R,
Williams
DL,
et
al.
Long-term
survival
and
viru-
lence
of
Mycobacterium
leprae
in
amoeba!
cysts.
PLoS
Negl
Trop
Dis.
2014;
8(12):e3405.
Epub
2014/
12/19.
doi:
10.1371/joumal.pntd.0003405
PMID:
25521850
25.
Saeed
A,
Abd
H,
Edvinsson
B,
Sandstrom
G.
Acanthamoeba
casteffanii
an
environmental
host
for
Shi-
gella
dysenteriae
and
Shigella
sonneL
Arch
Microbiol.
2009;
191(1):83-8.
Epub
2008/08/21.
doi:
10.
1007/s00203-008-0422-2
PMID:
18712360
26.
Abd
H,
Weintraub
A,
Sandstrom
G.
Intracellular
survival
and
replication
of
Vibrio
cholerae
0139
in
aquatic
free-living
amoebae.
Environ
Microbiol.
2005;
7(7):1003-8.
Epub
2005/06/11.
doi:
10.11114.
1462-2920.2005.00771.x
PMID:
15946296
27.
Mardare
C,
Delahay
RJ,
Dale
JW.
Environmental
amoebae
do
not
support
the
long-term
survival
of
viru-
lent
mycobacteria.
J
Appl
Microbiol.
2013;
114(5):1388-94.
Epub
2013/02/13.
doi:
10.1111/jam.12166
PM
ID:
23398391
28.
Wang-Ngarm
S,
Chareonsudjai
S,
Chareonsudjai
P.
Physicochemical
factors
affecting
the
growth
of
Burkholderia
pseudomallei
in
soil
microcosm.
Am
J
Trop
Med
Hyg.
2014;
90(3):480-5.
Epub
2014/01/
22.
doi:
10.4269/ajtmh.13-0446
PMID:
24445210
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
12
/
13
PLOS
ONE
Free-Living
Amoebae
from
Soil
Antagonize
Burkholderia
pseudomallei
29.
Bamforth
SS.
Isolation
and
counting
of
protozoa.
In:
Kassem
Alef
PN,
editor.
Methods
in
Applied
Soil
Microbiology
and
Biochemistry.
London,
UK:
Academic
Press;
1995.
p.
174-6.
30.
Page
FC.
A
New
Key
to
Freshwater
and
Soil
Gymnamoebae:
With
Instructions
for
Culture.
Ambleside,
Cumbria,
United
Kingdom:
Freshwater
Biological
Association,
Ferry
House;
1988.
31.
Suebrasri
T,
Wang-ngarm
S,
Chareonsudjai
P,
Sermswan
RW,
Chareonsudjai
S.
Seasonal
variation
of
soil
environmental
characteristics
affect
the
presence
of
Burkholderia
pseudomallei
in
Khon
Kaen,
Thai-
land.
AfrJ
Microbiol
Res.
2013;
7(19):1940-5.
32.
Wuthiekanun
V,
Anuntagool
N,
White
NJ,
Sirisinha
S.
Short
report:
a
rapid
method
for
the
differentiation
of
Burkholderia
pseudomallei
and
Burkholderia
thailandensis.
Am
J
Trop
Med
Hyg.
2002;
66(6):759-
61.
PMID:
12224587
33.
Novak
RT,
Glass
MB,
Gee
JE,
Gal
D,
Mayo
MJ,
Currie
BJ,
et
al.
Development
and
evaluation
of
a
real-
time
PCR
assay
targeting
the
type
III
secretion
system
of
Burkholderia
pseudomallei.
J
Clin
Microbiol.
2006;
44(1):85-90.
doi:
10.1128/JCM.44.1.85-90.2006
PMID:
34.
Techawiwattanaboon
T,
Bartpho
T,
Sermswan
RW,
Chareonsudjai
S.
Transcription
level
analysis
of
intracellular
Burkholderia
pseudomallei
illustrates
the
role
of
BPSL1502
during
bacterial
interaction
with
human
lung
epithelial
cells.
J
Microbiol.
2015;
53(2):134-40.
doi:
10.1007/s12275-015-4522-9
PMID:
35.
Cosson
P,
Soldati
T.
Eat,
kill
or
die:
when
amoeba
meets
bacteria.
Curr
Opin
Microbiol.
2008;
11
(3):271-6.
Epub
2008/06/14.
doi:
10.1016/j.mib.2008.05.00F
PMID:
18550419
36.
Winiecka-Krusnell
J,
Linder
E.
Bacterial
infections
of
free-living
amoebae.
Res
Microbiol.
2001;
152
(7):613-9.
PMID:
11605981
37.
Barker
J,
Brown
MR.
Trojan
horses
of
the
microbial
world:
protozoa
and
the
survival
of
bacterial
patho-
gens
in
the
environment.
Microbiology.
1994;
140
(Pt
6):1253-9.
Epub
1994/06/01.
38.
Huws
SA,
Morley
RJ,
Jones
MV,
Brown
MR,
Smith
AW.
Interactions
of
some
common
pathogenic
bac-
teria
with
Acanthamoeba
polyphaga.
FEMS
Microbiol
Lett.
2008;
282(2):258-65.
doi:
10.1111/j.1574-
6968.2008.01123.x
PMID:
18399997
39.
Akya
A,
Pointon
A,
Thomas
C.
Listeria
monocytogenes
does
not
survive
ingestion
by
Acanthamoeba
polyphaga.
Microbiology.
2010;
156(Pt
3):809-18.
Epub
2009/11/07.
doi:
10.1099/mic.0.031146-0
PMID:
19892759
40.
Fields
BS.
The
molecular
ecology
of
legionellae.
Trends
Microbiol.
1996;
4(7):286-90.
PMID:
8829338
41.
Swanson
M,
Hammer
B.
Legionella
pneumophila
pathogenesis:
a
fateful
journey
from
amoebae
to
mac-
rophages.
Annual
Reviews
in
Microbiology.
2000;
54(1):567-613.
42.
Dey
R,
Bodennec
J,
Mameri
MO,
Pernin
P.
Free-living
freshwater
amoebae
differ
in
their
susceptibility
to
the
pathogenic
bacterium
Legionella
pneumophila.
FEMS
Microbiol
Lett.
2009;
290(1):10-7.
Epub
2008/11/20.
doi:
10.1111/j.1574-6968.2008.01387.x
PMID:
19016886
43.
Xinyao
L,
Miao
S,
Yonghong
L,
Yin
G,
Zhongkai
Z,
Donghui
W,
et
al.
Feeding
characteristics
of
an
amoeba
(Lobosea:
Naegleria)
grazing
upon
cyanobacteria:
food
selection,
ingestion
and
digestion
progress.
Microb
Ecol.
2006;
51(3):315-25.
Epub
2006/04/07.
doi:
PMID:
16598635
44.
Postma
J,
van
Veen
JA.
Habitable
pore
space
and
survival
of
Rhizobium
leguminosarum
biovar
trifolii
introduced
into
soil.
Microb
Ecol.
1990;
19(2):149-61.
Epub
1990/03/01.
doi:
10.1007/BF02012096
PM
ID:
24196308
45.
Ronn
R,
McCaig
AE,
Griffiths
BS,
Prosser
JI.
Impact
of
protozoan
grazing
on
bacterial
community
struc-
ture
in
soil
microcosms.
Appl
Environ
Microbiol.
2002;
68(12):6094-105.
Epub
2002/11/27.
doi:
10.
1128/AEM.68.12.6094-6105.2002
PMID:
12450833
PLOS
ONE
I
D01:10.1371/journal.pone.0167355
November
29,
2016
13/
13