Cloning and functional characterization of a GNA-like lectin from Chinese Narcissus (Narcissus tazetta var. Chinensis Roem)


Gao, Z.M.; Zheng, B.; Wang, W.Y.; Li, Q.; Yuan, Q.P.

Physiologia Plantarum 142(2): 193-204

2011


A full-length cDNA encoding Narcissus tazetta lectin (NTL) was isolated from Chinese narcissus (N. tazetta var. Chinensis Roem). The open reading frame (ORF) was 519 bp long and encoded 172 amino acids with a theoretical isoelectric point of 5.27 and a calculated molecular mass of 18.6 kDa. Conserved domain analysis indicated that it possessed three D-(+)-mannose-binding sites, presumed to be similar to those of Galanthus nivalis agglutinin (GNA)-like lectins. A recombinant (glutathione S-transferase) GST-NTL fusion protein of around 40 kDa was successfully synthesized in vitro. Lysates of cells expressing this recombinant protein exhibited significant hemagglutinating activity [418 hemagglutinating units (HU)], as did the purified protein (265 HU). Sugar specificity assays suggested that mannose is the only sugar that significantly inhibits this hemagglutinating activity, confirming that NTL is a member of the GNA-like lectin family. NTL is highly transcribed in flowers, leaves and roots, but less so in scales. However, similar levels of the NTL protein were observed in all four of these organs by western blotting. A fluorescent NTL-GFP (green fluorescent protein) fusion protein was found to be primarily localized in the vacuole of transformed onion epidermal cells, indicating that NTL may be a vacuolar storage protein. This is the first study in which the function of NTL has been examined and provides a considerable body of data concerning its physiological role in Chinese narcissus. The results obtained may be useful in the molecular engineering of plants with enhanced tolerance of biotic and abiotic stresses. Moreover, they may be relevant to medical applications of lectins.

Physiologia
Plantarum
An
International
Journal
for
Plant
Biolog
Physiologia
Plantarum
142:
193-204.
2011
Copyright
©
Physiologia
Plantarum
2011,
ISSN
0031-9317
Cloning
and
functional
characterization
of
a
GNA-like
lectin
from
Chinese
Narcissus
(Narcissus
tazetta
var.
Chinensis
Roem)
Zhi
M.
Gaoa,
Bo
Zhenga,
Wen
Y.
Wangb•*,
Qiang
Lic
and
Qi
P.
Yuanb
alnternational
Center
for
Bamboo
and
Rattan,
SFA
Key
Open
Laboratory
on
Bamboo
and
Rattan
Science
and
Technology,
Beijing
100102,
China
b
College
of
Life
Science
and
Technology,
Beijing
University
of
Chemical
Technology,
Beijing
100029,
China
cDepartment
of
Chemical
Engineering,
Tsinghua
University,
Beijing
100084,
China
A
full-length
cDNA
encoding
Narcissus
tazetta
lectin
(NTL)
was
isolated
from
Chinese
narcissus
(N.
tazetta
var.
Chinensis
Roem).
The
open
reading
frame
(ORF)
was
519
bp
long
and
encoded
172
amino
acids
with
a
theoretical
isoelectric
point
of
5.27
and
a
calculated
molecular
mass
of
18.6
kDa.
Conserved
domain
analysis
indicated
that
it
possessed
three
D-(+)-mannose-
binding
sites,
presumed
to
be
similar
to
those
of
Galanthus
nivalis
agglutinin
(GNA)-like
lectins.
A
recombinant
(glutathione
S-transferase)
GST—NTL
fusion
protein
of
around
40
kDa
was
successfully
synthesized
in
vitro.
Lysates
of
cells
expressing
this
recombinant
protein
exhibited
significant
hemagglutinating
activity
[418
hemagglutinating
units
(HU)],
as
did
the
purified
protein
(265
HU).
Sugar
specificity
assays
suggested
that
mannose
is
the
only
sugar
that
significantly
inhibits
this
hemagglutinating
activity,
confirming
that
NTL
is
a
member
of
the
GNA-like
lectin
family.
NTL
is
highly
transcribed
in
flowers,
leaves
and
roots,
but
less
so
in
scales.
However,
similar
levels
of
the
NTL
protein
were
observed
in
all
four
of
these
organs
by
western
blotting.
A
fluorescent
NTL—GFP
(green
fluorescent
protein)
fusion
protein
was
found
to
be
primarily
localized
in
the
vacuole
of
transformed
onion
epidermal
cells,
indicating
that
NTL
may
be
a
vacuolar
storage
protein.
This
is
the
first
study
in
which
the
function
of
NTL
has
been
examined
and
provides
a
considerable
body
of
data
concerning
its
physiological
role
in
Chinese
narcissus.
The
results
obtained
may
be
useful
in
the
molecular
engineering
of
plants
with
enhanced
tolerance
of
biotic
and
abiotic
stresses.
Moreover,
they
may
be
relevant
to
medical
applications
of
lectins.
Correspondence
*Corresponding
author,
e-mail:
wangwy@mail.buct.edu.cn
Received
20
October
2010;
revised
16
December
2010
doi:10.1111/j.1399-3054.2011.01449.x
Introduction
Lectins
are
a
class
of
proteins
that
are
found
in
a
variety
of
plants,
including
Leguminosae,
Solanaceae,
Euphor-
biaceae,
Poaceae,
Liliaceae
and
Amaryllidacea,
and
bind
specifically
to
certain
carbohydrates
(Van
Damme
et
al.
1987,
1998,
2008).
On
the
basis
of
their
number
of
carbohydrate-binding
domains,
the
lectins
can
be
clas-
sified
into
three
major
families:
the
merolectins
(which
contain
one
binding
domain),
the
hololectins
(fusion
proteins
containing
one
or
more
identical
or
highly
homologous-binding
domains)
and
the
chimerolectins
Abbreviations
EDTA,
ethylene
diamine
tetraacetie
acid;
GFP,
green
fluorescent
protein;
GNA,
Galanthus
nivalis
agglutinin;
GST,
glutathione
S-transferase;
HU,
hemagglutinating
unit;
IPTG,
isopropyl
/3-D-1-thiogalactopyranoside;
kDa,
kilodaltons;
LB,
lysogeny
broth;
MBLs,
mannose-binding
lectins;
ORF,
open
reading
frame;
PBS,
phosphate-buffered
saline;
RACE,
rapid
amplification
of
cDNA
ends;
RT-PCR,
reverse
transcription-polymerase
chain
reaction;
SDS-PAGE,
sodium
dodecyl
sulfate
polyacrylamide
gel
electrophoresis;
UTR,
untranslated
regions.
Physiol.
Plant.
142,
2011
193
(proteins
incorporating
two
or
more
unrelated
domains).
On
the
basis
of
their
carbohydrate-binding
specificity,
they
can
be
further
divided
into
seven
families
(Van
Damme
et
al.
1998).
Currently,
based
on
their
domain
structures
and
phylogenetic
analyses
from
rice,
ara-
bidopsis
and
soybean
sequences,
12
different
families
have
been
identified,
4
of
which
exclusively
contain
recently
identified
plant
lectins
(Jiang
et
al.
2010).
As
Galanthus
nivalis
agglutinin
(GNA)-like
lectins
were
initially
isolated
from
monocot
species and
bind
specifically
to
mannose,
they
were
typically
referred
to
as
'monocot
mannose-binding
lectins
(MBLs)'
(Van
Damme
et
al.
2008),
although
this
terminology
has
begun
to
fall
out
of
favor.
In
the
wake
of
the
identification
of
the
first
GNA-like
lectins,
several
other
examples
were
isolated
from
various
tissues
of
a
number
of
genera and
species,
including
Araceae,
Al
I
iaceae
and
Amaryl
I
idaceae
(Galanthus
nivalis,
Allium
schoenoprasum,
Lycoris
radiata,
Hippeastrum
vittatum
and
Narcissus
hybrid
cultivar)
(Liu
et
al.
2009).
Proteins
in
this
family
have
been
studied
extensively
because
of
their
interesting
biological
properties:
they
are
specific
inhibitors
of
tumor
growth
and
retroviral
infection
(Witvrouw
et
al.
2005)
and
play
a
role
in
plants'
defenses
against
insect
predators
such
as
the
Homoptera
(Jouanin
et
al.
1998,
Rudiger
and
Gabius
2001,
Bravo
et
al.
2008).
GNA-like
lectins
from
daffodils
(Narcissus
tazetta)
exhibit
immunomodulatory
activity
against
insect
attacks
and
human
immunodeficiency
virus
(HIV)
infection
(Linda
et
al.
2010).
These
properties
of
the
GNA-like
lectins
mean
that
the
genes
encoding
them
have
potential
agricultural
applications
involving
the
use
of
transgenic
technology,
such
as
improving
plants'
tolerance
of
or
resistance
to
various
insects.
For
example,
the
lectin
gene
from
snowdrop
has
been
transferred
into
crops
to
increase
their
resilience
(Pang
et
al.
2004).
To
date,
several
GNA-like
lectins
from
daffodils
have
been
purified
and
studied.
Optimized
procedures
for
their
purification
have
been
developed,
they
have
been
crystallized
and
their
structure
has
been
determined,
and
their
activity
against
HIV
and
the
rabies
virus
has
been
examined
(Linda
et
al.
1998,
2000a,
2000b,
2001,
2010).
Although
there
are
more
than
200
genes
encoding
lectins
in
daffodils,
detailed
information
on
their
gene
expression
patterns
and
on
the
localization
of
the
proteins
is
still
lacking.
Chinese
narcissus
(N.
tazetta
var.
Chinensis
Roem)
is
a
famous
ornamental
plant
in
China
and
is
remarkably
resistant
to
sap-sucking
insects.
Our
group
has
previously
reported
the
isolation
of
two
genes
encoding
GNA-like
lectins
from
Chinese
narcissus
along
with
the
putative
three-dimensional
structures
and
amino
acid
sequences
of
the
proteins
they
encode
(Liu
et
al.
2009,
Yu
et
al.
2009).
This
article
describes
the
isolation
of
a
new
GNA-like
lectin
from
Chinese
narcissus.
The
physiological
characteristics
of
the
encoded
lectin
were
studied
using
protein
expressed
in
vitro.
In
addition,
the
transcription/expression
pattern
and
subcellular
localization
of
N.
tazetta
lectin
(NTL)
in
vivo
were
also
investigated
thoroughly.
To
our
knowledge,
this
is
the
first
attempt
to
explore
the
function
of
NTL
from
Chinese
narcissus
using
techniques
from
biochemistry
and
molecular
biology
to
shed
light
on
the
function
of
NTL
and
on
how
it
might
be
exploited
in
agriculture
to
improve
plants'
tolerance
of
biotic
and
abiotic
stress.
The
results
obtained
may
also
be
informative
in
terms
of
the
potential
applications
of
lectins
in
medicine
and
in
biology
in
general.
Materials
and
methods
Plant
materials
and
strains
Three-year-old
bulbs
of
the
Chinese
narcissus
cultivar
'Jinzhanyintai'
were
purchased
from
Zhangzhou
in
Fujian
Province,
China,
in
2009.
The
bulbs
were
soaked
in
fresh
water
and
grown
in
growth
chambers
under
long-day
conditions
(16-h
light/8-h
dark)
at
22
°
C
with
a
light
intensity
of
150
µ,mol
m
-2
s
-1
.
The
roots,
bulb
scales,
leaves
and
flowers
were
collected
at
full-bloom
stage,
frozen
with
liquid
nitrogen
and
stored
at
—80°C
until
needed
for
use
in
experiments.
Escherichia
coli
DH5a
was
used
as
the
recipient
in
routine
cloning
experiments.
Escherichia
coli
BL21
(DE3)
was
used
for
NTL
expression
in
vitro.
Isolation
of
NTL
cDNA
and
sequence
analysis
Total
RNA
was
isolated
from
the
leaves
of
Chinese
narcis-
sus
with
Trizol
(I
nvitrogen,
Carlsbad,
CA)
according
to
an
isolation
protocol
recommended
by
the
manufacturer.
First-strand
cDNA
was
synthesized
from
500
ng
of
RNA
using
the
Promega
cDNA
synthesis
system;
the
cDNA
was
used
as
a
template
to
amplify
the
gene.
3'cDNA
and
5'cDNA
were
synthesized
using
the
SMARTT"'
RACE
kit
(Clontech,
Mountain
View,
CA).
Primers
(NTL-F:
5'-TCATTCTGGCCACCATCTTC-3';
NTL-R:
5'-T
GGCGGCCACTAACTTTATC-3')
were
designed
based
on
the
sequence
of
the
conservative
domain
of
GNA-
like
lectins
from
monocots. Gradient
PCR
amplification
was
performed
with
NTL-F
and
NTL-R
to
optimize
the
annealing
temperature.
Specific
primers
were
designed
according
to
the
sequences
obtained
using
the
procedure
described
above.
The
primers
used
for
5'
rapid
amplification
of
cDNA
ends
(RACE)
were
NTL5-1
(5'-GCAGTAGGATA
TCTCTCCGAGGGGGGTG-3')
and
NTL5-2
(5'-TCCCG
TCGCTCTGCATGTTGAGGTGGC-3');
those
used
for
194
Physiol.
Plant.
142,
2011
3'
RACE
were
NTL3-1
(5'-TGCCACCTCAACATGCAGA
GCGACGGG-3')
and
NTL3-2
(5'-TCACCCCCCTCGGA
GAGATATCCTACTG-3').
Touchdown
PCR
was
per-
formed
with
NTL5-1,
NTL3-1
and
a
universal
primer
mix
[(UPM)
as
supplied
with
the
SMART
RACE
cDNA
Amplification
Kit]
and
the
PCR
amplicons
were
used
as
templates
for
a
subsequent
nested
PCR
using
the
NUP
primer
supplied
in
the
kit
together
with
either
NTL5-2
or
NTL3-2.
The
PCR
fragments
were
cloned
into
pGEM-T
Easy
Vectors
(Promega,
Madison,
WI)
using
a
standard
protocol
and
sequenced
using
an
ABI
3730
sequencer
(Applied
Biosystems,
Bedford,
MA).
The
full-length
cDNA
was
obtained
by
combining
the
con-
served
sequence
with
the
5'
and
3'
end
sequences.
On
the
basis
of
this
assembled
sequence,
the
sequence
of
the
open
reading
frame
(ORF)
was
obtained
from
the
cDNA
using
the
Pyrobest
DNA
polymerase
(Takara
Biotechnology
Co.,
Ltd,
Dalian,
China)
with
the
NTL
O
F
(5'-ATGGCTAAGACAAGCTTCCTC-3')
and
NTLoR
(5'-
TTACCTTGGCGGCCACTAACTTTATC-3')
primers.
The
ORF
sequence
was
confirmed
by
sequencing
(ABI
3730).
Sequence
analysis
was
carried
out
with
the
DNASTAR
software
package;
known
motifs
within
the
sequence
were
identified
by
comparison
with
a
database
of
such
motifs
using
the
web-based
MOTIF
SCAN
tool
(http://myh
its.
isb-sib.ch/cgi-bin/motif_scan)
.
The
full-length
cDNA
sequence
was
subjected
to
a
similarity
search
against
the
NCBI
database
(http://www.ncbi.nlm.nih.gov
)
using
the
BLASTX
algorithm
with
default
parameters.
A
neigh-
bor
joining
(NJ)
tree
was
constructed
using
the
MEGA4.0
software
package
and
the
CLUSTAL
algorithm
in
conjunc-
tion
with
the
amino
acid
sequences
of
known
GNA-like
lectins
(Tamura
et
al.
2007).
Semi-quantitative
RT-PCR
For
gene
expression
analysis,
total
RNA
was
isolated
from
roots,
bulb
scales,
leaves
and
flowers
using
Trizol
(Invitrogen).
First-strand
cDNAs
were
synthesized
using
500
ng
of
RNA
isolated
from
the
appropriate
tissue
using
AMV
reverse
transcriptase
(Promega).
PCR
was
performed
with
the
NTL-F
and
NTL-R
primers
in
a
final
volume
of
20
µI,
made
up
of
10µl
of
2
xGC
Buffer
I
(Mg
2
+
Plus),
3.2
ill
of
dNTPs
(2.5
mM
each
of
dATP,
dTTP,
dCTP
and
dGTP),
2µl
of
NTL-F
and
NTL-R
(5
µ,M,
each),
1µl
template,
1.6
ill
Milli
Q-water
(MQW)
and
0.2
ill
LA
Taq
DNA
polymerase
(Takara
Biotechnology
Co.,
Ltd).
The
length
of
the
expected
fragment
was
around
500
bp.
The
PCR
program
involved
an
initial
denaturation
period
at
94
°
C
for
5
min,
followed
by
28
cycles
of
94°C
for
1
min,
65°C
for
1
min
and
then
72°C
for
1
min;
after
the
last
cycle,
there
was
a
final
extension
period
at
72°C
for
10
min.
The
cDNA
fragment
arising
from
the
18S
rRNA
was
amplified
as
a
positive
control
under
the
same
PCR
conditions
using
N18SF2
(5'-GA
CTCCGCCGGCACCTTATGAG-3')
and
N18SR2
(5'-CG
CCGCGATCCGAACACTTC-3')
primers
designed
on
the
basis
of
the
18S
rRNA
sequence
from
the
Chinese
narcissus
(accession
no.
EU715294).
Expression
of
the
recombinant
protein
The
fragment
of
NTL
that
encodes
the
mature
pro-
tein
was
re-amplified
by
PCR
to
introduce
Ndel
(for-
ward)
and
Xhol
(reverse)
sites
or
BamHI
and
Notl
sites.
Fragments
incorporating
Ndel
and
Xhol
sites
or
BamHI
and
Not
sites
were
cloned
into
the
pET-23a
or
pGEX-6P-1-H
[which
carries
a
poly-His
tag
in
addition
to
glutamine
transferase
(GST)]
vectors,
respectively.
The
primers
used
to
generate
fragments
incorporat-
ing
Ndel
and
Xhol
sites
were
NTLmF1
(5'-AACATATG
GACAACAACATTCTCTACTCCG-3')
and
NTLmR1
(5'-C
TCGAGCTTGGCGGCCACTAACTTTAT-3');
those
used
to
generate
fragments
incorporating
BamHI
and
Notl
recognition
sites
were
NTLmF2
(5'-TTGGATCCATGGAC
AACAACATTCTCTACTC-3')
and
NTLmR2
(5'-AATGCG
GCCGCTTACTTGGCGGCCACTAA-3');
the
Ndel,
Xhol,
BamHI
and
Notl
recognition
sequences
in
the
primers
are
underlined.
The
design
of
these
primers
was
based
on
the
full-length
cDNA
sequence
of
NTL.
After
sequencing
both
strands
of
the
fragment
encoding
the
mature
protein,
the
recombinant
plas-
mids
carrying
pET-23a-NTL
and
pGEX-6P-1-H-NTL
were
transformed
into
competent
E.
coli
strain
BL21(DE3)
cells
for
protein
expression.
BL21(DE3)
cells
harboring
pET-23a-NTL,
pGEX-6P-1-H-NTL
or
an
empty
vector
(pET-23a
or
pGEX-6P-1-H)
were
cul-
tured
at
37
°
C,
in
lysogeny
broth
(LB)
liquid
medium
containing
100
µ,g
m1
-1
of
ampicillin
until
an
0D600
of
approximately
0.6
was
attained.
The
medium
was
then
supplemented
with
0.1
mM
isopropyl
fl-D-1-
thiogalactopyranoside
(IPTG)
and
the
E.
coli
cells
were
cultured
at
37°C
for
an
additional
4
h
to
induce
synthesis
of
the
recombinant
protein.
The
recombinant
GST-NTL
protein
was
purified
as
follows:
The
bacterial
culture
was
centrifuged
at
10
000
g
at
4°C
for
10
min.
The
bacterial
pellet
was
then
re-suspended
in
lysis
buffer
(100
mM
NaCI,
2
mM
EDTA
and
50
mM
Tris-HCI,
pH
=
8.0).
The
suspension
was
supplemented
with
10
mg
m1
-1
of
lysozyme
and
then
incubated
for
10
min
at
room
temperature,
after
which
the
cells
were
lysed
at
4
°
C
by
supersonication.
The
lysates
were
centrifuged
at
10
000
g
and
4
°
C
for
20
min
and
the
supernatant
was
separated
and
mixed
with
50%
Ni-NTA
His-Bind
slurry
(Novagen,
Physiol.
Plant.
142,
2011
195
Darmstadt,
Germany)
by
shaking
at
200
r.p.m.
on
a
rotary
shaker
at
4°C
for
60
min.
The
lysate-Ni-
NTA
His-Bind
mixture
was
loaded
onto
a
column,
which
was
then
washed
with
washing
buffer
(300
mM
NaCI,
50
mM
sodium
phosphate
buffer
and
20
mM
imidazole,
pH
=
8.0).
The
purified
GST-NTL
protein
was
collected
by
washing
the
column
with
elution
buffer
(300
mM
NaCI,
50
mM
sodium
phosphate
buffer
and
250
mM
imidazole,
pH
=
8.0).
The
recombinant
protein
was
analyzed
using
12%
sodium
dodecyl
sulfate
polyacrylamide
gel
electrophoresis
(SDS-PAGE)
according
to
the
method
of
Linda
et
al.
(2010).
Assays
of
the
hemagglutinating
activity
of
NTL
and
its
inhibition
The
recombinant
protein's
hemagglutinating
activity
was
determined
in
microtiter
plates
as
described
by
Liener
(1955)
and
Turner
and
Liener
(1975),
using
trypsin-
treated
rabbit
erythrocytes.
The
inhibition
of
this
activity
by
sugars
was
measured
using
the
same
assay;
in
these
experiments,
serial
dilutions
of
the
sugar
were
incubated
with
10µg
m1
-1
GST-NTL
for
1
h
at
room
temperature
before
adding
the
erythrocytes.
Western-blot
analysis
Most
of
the
recombinant
NTL
protein
produced
by
BL21
(DE3)
cells
harboring
pET-23a-NTL
precipitates
and
forms
inclusion
bodies;
there
is
comparatively
little
solu-
ble
protein.
Therefore,
these
inclusion
bodies
were
used
to
prepare
polyclonal
antibodies.
The
inclusion
bodies
were
purified
using
Ni-NTA
His-Bind
Resins
(Novagen)
according
to
the
following
purification
protocol:
The
bacterial
culture
was
centrifuged
at
10
000
g
for
10
min.
The
pellet
was
then
re-suspended
in
solubilizing
buffer
(8
M
urea,
0.1
M
sodium
phosphate
buffer
and
0.01
M
Tris-CI,
pH
=
8.0)
and
vortexed
gently.
The
resulting
lysate
was
centrifuged
at
10
000
g
for
20-30
min
at
room
temperature
to
remove
the
cellular
debris.
The
supernatant
was
mixed
with
50%
Ni-NTA
His-Bind
slurry
(Novagen)
by
shaking
for
30
min
at
200
r.p.m.
The
lysate-resin
mixture
was
carefully
loaded
onto
an
empty
column
(Novagen)
and
the
resin
was
washed
with
washing
buffer
(8
M
urea,
0.1
M
sodium
phosphate
buffer,
0.01
M
Tris-CI,
pH
=
6.3)
and
then
with
elu-
tion
buffer
(8
M
urea,
0.1
M
sodium
phosphate
buffer
and
0.01
M
Tris-CI,
pH
=
4.5)
to
elute
the
purified
NTL
inclusion
bodies.
The laboratory
animals
used
to
prepare
the
polyclonal
antibodies
were
male
mice.
The
mice
were
initially
injected
with
purified
NTL
protein
in
complete
Freund's
adjuvant.
One
month
later,
they
were
boosted
with
purified
NTL
protein
in
incomplete
Freund's
adjuvant;
2
weeks
after
that,
they
received
a
second
boost
with
purified
NTL
protein
in
incomplete
Freund's
adjuvant.
One
week
after
the
second
boost,
serum
was
collected
from
the
blood
of
the
mice's
tails
for
western
blotting.
Western
blotting
proteins
from
Chinese
narcissus
were
extracted
using
a
modified
version
of
the
protocol
described
by
BerLiter
and
Feusi
(1997).
Frozen
tissues
(5
g)
from
different
plant
organs
were
ground
to
a
fine
powder
in
a
mortar
using
a
pestle,
while
being
cooled
with
liquid
nitrogen.
The
tissue
powder
was
mixed
with
1
x
SDS
loading
buffer
(10%
glycerin,
50
mM
Tris-CI
(pH
=
6.8),
2%
two-mercaptoethanol,
0.2%
bromophe-
nol
blue
and
2%
SDS).
The
mixture
was
heated
at
100
°
C
for
5
min
and
then
centrifuged
at
10
000
g
at
room
temperature
for
10
min.
The
supernatant
was
used
for
SDS-PAGE
analysis
by
the
molecular
clone
procedure
(Sambrook
et
al.
1989):
15µg
of
the
extracted
protein
was
loaded
on
each
lane
and
then
electro-transferred
to
a
nitrocellulose
membrane
in
the
transfer
medium
(25
mM
Tris,
192
mM
glycine
and
20%
methanol
(v/v))
at
4°C
for
2
h.
After
washing
with
PBST
[0.2%
Tween
in
phosphate-buffered
saline
(PBS)],
the
nitrocellulose
membrane
was
submerged
in
blocking
solution
(PBST
containing
5%
skimmed
milk
powder)
and
gently
shaken
for
1
h
at
room
temperature.
The
blocking
solution
was
then
discarded
and
the
hybridizing
membrane
was
incu-
bated
in
a
solution
of
the
primary
antibody
in
blocking
solution
(1:1000)
by
gently
shaking
for
1
h.
The
mem-
brane
was
then
washed
with
PBST
and
incubated
in
a
solution
of
goat
anti-mice
antibody
in
PBST
(1:1000)
at
room
temperature
for
1
h.
The
membrane
was
then
thoroughly
washed
with
PBST
and
developed
using
the
ECL
kit
(Thermo
Scientific,
Waltham,
MA).
Subcellular
localization
of
NTL
The
coding
sequence
of
NTL
was
amplified
using
primers
that
introduced
an
Xbal
site
upstream
of
the
start
codon
and
a
BamHl
site
downstream
of
the
ORF.
The
PCR
products
carrying
the
upstream
Xbal
and
down-
stream
BamHl
sites
were
then
ligated
into
pPZP
vector
that
had
been
pre-digested
with
Xbal
and
BamHl
to
generate
the
CaMV
35S::NTL-GFP
(green
fluorescent
protein)
construct;
the
identity
of
the
construct
was
ver-
ified
by
sequencing.
The
primers
used
to
generate
the
fragment
carrying
Xbal
and
BamHl
sites
were
NTL
O
F
(5'-AA
TCTA
GAATGGCTAAGACAAGCTTCCTC-3')
and
NTL
0
R
(5'
GGATCCCTTGGCGGCCACTAACTTTATC-3')
and
were
designed
on
the
basis
of
the
sequence
of
the
full-length
cDNA
of
NTL;
the
Xbal
and
BamHl
recognition
sites
are
underlined.
The
pPZP
vector
with
196
Physiol.
Plant.
142,
2011
-28
AAACAAGCAATCAACACAAAGTTGCAAG
1
ATGGCTAAGTCAAGTTICCTCATICTGGCCACCATCTTCCTIGGGGCCATCACTGTATCA
MAKSSFLILATIFLGAITVS
61
TCITGCCTCGGTGACAACAACATICTCTACTCCGGTGAGACTCTCTCTCCCGGAGAGTTT
SCLGDNNILYSGETLSPGEF
121
CT
CAACTACGGTAGATATA
TCA
TGC
AAGAG
CA
CTG
CAA
TIT
GGT
CTT
GTA
CGA
C
LNYGRYIFIMEDCNLVLYD
181
GT
CGACAAGCCTA
TCTG
GGCAA
CAAACA
CGG
GTGGCCT
CGC
CCG
TGA
CCA
CCT
CAA
C
YDKPIWATNTGGLARDCHLN
241
ATGCAGAGCGACGGGAACCTCGTOGIGTKAGCCAAACGAACGACCCGATTIGGGCGAGC
MQSDGNLVVYSQTNDPIAS
301
AACACCGGAGGCGAGAAIGGGAATTACGTGTGCGTCCTICAGAAGGATCGGAACGTTGTG
N
TGGENGYYCYLQKDRNYY
361
ATCTACGGAACTG-CTCGCTGGGCTACTGGAACATACACCGG-CGCTGTAGGAATTCCCGAA
I
YG
T
AR
Vi
A
TG
T
Y
TGA
V
G
I
P
E
421
TCACCCOCCTCGWAGATATCCTACTGCTGGAAAGATAACACTGGCCTCGGAGAAATAT
SPPSERYPTAGK
I
TLASEKY
481
CCTACTACTCrGAAAGATAAAGTTAGTGGCCGCCAAGTAATCACCTGAGATCTTTAAACCT
PTTCTKIKLVAAK
541
CGCGTGCATGTGAGAAGAGTAA
TAAAAT
ACGTGGA
TTGGAGATCAATGTACGGTGTCCAG
601
CCTTCTGGTGGACGAAAAAATAAATAAGTATCATGTATGCATGCGTTTGATAATGAAGAC
661
TTCTTTGCAGTACTC
Fig.
1.
The
nucleotide
and
predicted
amino
acid
sequences
of
Narcissus
tazetta
lectin
(NTL).
The
full
length
of
NTL
is
773
bp,
with
a
519
bp
open
reading
frame
encoding
a
putative
peptide
of
172
amino
acids.
The
residues
comprising
the
24-amino
acid
SP
that
precedes
D25
are
underlined.
The
three
conserved
regions
(Q_D_N_V_Y)
that
make
up
the
mannose-binding
sites
are
highlighted
in
gray;
Asterik
indicates
the
position
of
the
stop
codon.
CaMV
35S::GFP
was
used
as
a
control.
Onion
epi-
dermal
cells
were
placed
inside-up
on
MS
medium
and
subjected
to
biolistic
transformation
with
the
pPZP
constructs
by
bombardment
with
DNA-coated
gold
nanoparticles
using
the
PDS-1000/He
system
(Bio-Rad)
at
1100
p.s.i.
After
bombardment,
the
samples
were
incubated
at
25°C
overnight.
GFP
fluorescence
was
induced
by
excitation
at
488
nm
with
an
argon
laser
(Chen
et
al.
2007)
and
observed
under
a
confocal
fluo-
rescence
microscope
(Axiovert
S100,
Zeiss,
Germany).
Results
Cloning
and
sequence
analysis
of
NTL
cDNA
A
495
bp-long
partial
sequence
of
a
new
lectin
from
the
Chinese
narcissus
cultivar
'Jinzhanyintai'
was
obtained
by
reverse
transcription-polymerase
chain
reaction
(RT-PCR)
using
primers
based
on
the
conserved
regions
of
plant
lectins.
Blastx
analysis
showed
that
the
sequence
exhibited
close
homology
with
known
lectins.
Subsequently,
a
321
bp
fragment
at
the
5'
end
and
a
288
bp
fragment
at
the
3'
end
were
obtained
by
5'
and
3'
RACE,
respectively.
After
analysis
of
the
extended
sequence,
a
736
bp
full-length
cDNA
was
identified
containing
a
519
bp
ORF,
a
28
bp
5'
untranslated
region
(UTR)
and
a
189
bp
3'
UTR.
The
ORF
encodes
a
putative
peptide
of
172
amino
acids
including
a
24-amino
acid
signal
peptide
(SP)
consisting
of
the
residues
preceding
D25
(underlined)
and
a
mature
polypeptide
of
148
residues
(Fig.
1).
The
theoretical
isoelectric
point
(pi)
and
calculated
molecular
mass
of
the
protein
were
5.27
and
18.6
kDa,
respectively.
According
to
a
MOTIF
SCAN
search,
the
putative
protein
possesses
a
Bulb-type
lectin
domain
(from
N26
to
G134),
a
prokaryotic
membrane
lipoprotein
lipid
attachment
site
(from
M1
to
C22),
two
Casein
kinase
II
phosphorylation
sites
(from
S36
to
E39
and
from
T102
to
E105),
Physiol.
Plant.
142,
2011
197
AAA33551
59
AAA33550
PA433-548
89
AAA33549
AAA
3.3548
h
l
aA
ACN77849
1NPL
A
95
t
AAW22055
AAA159i2
AAA19910
AAA19911
71
NIL
AAW22054
AAPVG75
AAP57409
AAA33345
AAM27
4417
99
FAAIN943131
AAP20877
L
r
12
BA17:4987G7
BAD98796
AAA33349
JEW
18
P30617
AAA9.147
AAL07474
AvkL07476
AAPs33.148
73
AAL07475
AAL07477
II
AAL07478
two
N-myristoylation
sites
(from
G103
to
N108
and
from
G130
to
A135),
three
D-(+)-mannose-binding
sites
(Q_D_N_V_Y,
from
Q51
to
Y59,
Q82
to
Y90
and
Q114
to
Y122,
respectively)
and
four
protein
kinase
C
phosphorylation
sites
(from
T124
to
R126,
S144
to
R146,
S157
to
K159
and
T163
to
K165,
respectively)
(Fig.
1).
All
the
above
features
are
consistent
with
the
suggestion
that
the
gene
encodes
a
member
of
the
GNA-
like
lectin
family.
We
therefore
designated
the
gene
NTL
(Genbank
accession
no.
HM991259).
Phylogenetic
analysis
of
NTL
Homology
searches
indicated
that
NTL
shares
a
high
sequence
similarity
with
lectin
proteins
from
30
organisms,
with
sequence
identities
in
excess
of
65%.
Sequence
analysis
indicated
that
these
proteins
have
a
conserved
man
nose-binding
domain
(Q_D_N_V_Y)
and
that
the
differences
between
the
homologous
protein
sequences
are
mainly
because
of
variation
in
their
N-terminal
SPs,
which
vary
across
different
species
and
also
within
individual
species
(Appendix
S1,
Supporting
information).
For
instance,
NTL,
NTL1
and
NTA
are
all
GNA-like
lectins
from
Chinese
narcissus.
The
sequence
identity
of
NTL
with
NTL1
and
NTA
is
97.7
and
95.3%,
respectively;
however,
if
one
restricts
the
comparison
to
the
sequences
of
the
SPs
only,
the
sequence
identity
with
NTL
drops
to
87.5
and
91.7%
for
NTL1
and
NTA,
respectively
(data
not
shown).
An
NJ
tree
was
constructed
by
aligning
the
predicted
amino
acid
sequence
of
GNA-like
lectins
from
Narcissus,
Lycoris,
Clivia,
Zephyranthes,
Hippeastrum,
Narcissus
pseudonarcissus
and
Galanthus.
It
was
found
that
GNA-
like
lectins
from
Chinese
narcissus
(NTL,
NTL1
and
NTA)
and
N.
pseudonarcissus
(1
NPL_A)
are
clustered
in
the
same
group,
indicating
that
they
are
closely
related
(Fig.
2).
The
next
most
closely
related
species
to
Chinese
narcissus
is
Lycoris,
followed
by
Clivia,
while
Galanthus
is
comparatively
distantly
related.
Notably,
the
GNA-
like
lectins
from
the
Narcissus
hybrid
cultivar
were
located
in
a
different
cluster
to
those
from
Narcissus
itself
(Fig.
2).
Overall,
the
results
obtained
were
consistent
with
the
established
taxonomic
relationships
between
the
species.
Characterization
of
recombinant
NTL
Recombinant
NTL
protein
was
expressed
by
transform-
ing
E.
coli
with
the
pET-23a-NTL
construct.
However,
the
protein
exhibited
a
strong
tendency
to
form
inclu-
sion
bodies
and
was
very
difficult
to
detect
in
the
supernatant
of
the
lysate.
Consequently,
a
new
NTL
expression
vector,
pGEX-6P-1-H-NTL,
was
constructed
Fig.
2.
Phylogenetic
comparison
of
Narcissus
tazetta
lectin
(NTL)
with
other
related
Galanthus
nivalis
agglutinin
(GNA)-like
lectins
based on
their
predicted
amino
acid
sequences
using
MEGA
4.0.
Numbers
above
major
branches
indicate
bootstrap
value
estimates
for
1000
replicates;
amino
acid
sequences
that
cluster
together
are
grouped
under
their
genus
or
cultivar
of
origin.
The
GNA-like
lectins
used
in
drawing
up
this
phylogenetic
tree
were
AAA33551,
AAA33550, AAA33546,
AAA33549
and
AAA33548
from
Narcissus
hybrid
cultivar
2;
NTA
and
ACN77849
from
Narcissus
tazetta
var.
Chinensis;
1NPLA
from
Narcissus
pseudonarcissus;
AAW22054
and
AAW22055
from
Lycoris
sp.
JKB-2004;
AAA19912, AAA19910,
AAA19911
and
AAP20877
from
Clivia
miniata;
BAD98796
and
BAD98797
from
L.
radiata;
AAM94381
and
AAM27447
from
Zephyranthes
candida;
AAP37975
and
AAP57409
from
Hippeastrum
vittatum;
AAA33345,
AAA33349,
JE0136,
P30617,
AAA33347,
AAL07474,
AAL07476,
AAA33348,
AAL07475,
AAL07477
and
AAL07478
from
Galanthus
nivalis.
and
used
to
obtain
soluble
NTL.
The
pGEX
plasmid
and
its
derivatives
give
rise
to
GST
fusion
proteins;
the
GST
tag
facilitates
protein
expression
analysis
and
can
improve
the
solubility
of
recombinant
proteins.
The
pGEX-6P-1-H
plasmid
used
in
this
study
was
derived
198
Physiol.
Plant.
142,
2011
2
3
4
80
kDa—*
60
kDa—*
40
kDa
wool
1—
30
kDa—p-
ZEE
20
kDa—*
12
kDa—*
Fig.
3.
Detection
of
the
recombinant
protein
His-glutamine
5-
transferase
(GST)—Narcissus
tazetta
lectin
(NTL)
by
sodium
dodecyl
sulfate
polyacrylamide
gel
electrophoresis
(SDS-PAGE).
Lane
M
contains
the
protein
marker;
lane
1
contains
the
supernatant
of
induced
Escherichia
coli
transformed
with
pGEX-6P-1-H;
lane
2
contains
the
supernatant
of
induced
E.
co/i
transformed
with
pGEX-6P-1-H-NTL;
lane
3
contains
purified
GST
and
lane
4
contains
purified
GST—NTL.
The
mass
of
the
recombinant
protein
was
around
40
kDa;
its
position
on
the
gel
is
indicated
with
an
arrow.
from
pGEX-6P-1
by
attaching
a
six-histidine-tag
at
the
N
terminus
of
the
recombinant
protein.
Production
of
a
new
recombinant
protein
with
a
mass
of
around
40
kDa
was
observed
shortly
after
induction
with
0.1
mM
IPTG
at
37°C
in
cells
transformed
with
pGEX-6P-1-H-NTL;
fusion
with
GST
significantly
improved
NTL's
solubility
(Lane
4,
Fig.
3).
The
supernatant
of
the
lysate
obtained
from
trans-
formed
E.
coli
cells
expressing
NTL
exhibited
a
hemag-
glutinating
activity
of
418
hemagglutinating
units
(HU);
the
activity
of
the
purified
recombinant
fusion
pro-
tein
was
265
HU
(Table
1).
Nine
different
sugars
were
examined
as
potential
inhibitors
of
this
hemagglutinat-
ing
activity;
of
these,
only
mannose
had
any
effect,
inhibiting
NTL-promoted
hemagglutination
at
concen-
trations
between
62.5
and
250
mM.
GST
did
not
cause
detectable
hemagglutination
within
the
testing
range
and
its
(lack
of)
activity
did
not
vary
in
the
presence
of
any
of
the
sugars,
indicating
that
the
specificity
of
NTL
is
Table
1.
Hemagglutinating
activity
of
His-GST—NTL.
Protein-containing
material
His-GST
(HU)
His-GST—NTL
(HU)
0
0
418
265
Table
2.
Minimum
concentrations
of
different
sugars
required
to
inhibit
the
hemagglutination
activity
of
recombinant
NTL.The
hemagglutination
inhibition
tests
were
performed
using
a
protocol
similar
to
that
employed
in
the
hemagglutination
test.
Serial
twofold
dilutions
of
sugar
samples
were
prepared
in
phosphate-buffered
saline
(PBS).
Individual
dilutions
were
mixed
with
an
equal
volume
of
lectin
solution
containing
101.19
m1
-1
(glutamine
transferase)
GST—NTL
(Narcissus
tazetta
lectin).
The
mixture
was
allowed
to
stand
for
1
h
at
25°C
and
then
mixed
with
an
equal
volume
of
rabbit
erythrocyte
suspension.
The
GST
was
also
used
as
a
control
in
the
hemagglutination
inhibition
tests.
indicates
that
no
hemagglutination
was
observed
within
the
testing
range.
a
No
inhibition
at
a
final
sugar
concentration
of
250
mM
(the
highest
concentration
used).
b
Values
indicate
the
range
of
sugar
concentrations
over
which
inhibition
of
hemagglutination
was
observed.
Sugar
Minimum
sugar
concentration
required
to
effect
inhibition
of
hemagglutination
(mM)
GST
GST—NTL
i-Arabinose
>250a
D-Galactose
>250
D-Glucose
>250
D-Lactose
>250
D-Maltose
>250
D-Mannose
62.5-250b
D-Xylose
>250
D-Raffinose
>250
D-Rhamnose
>250
D-Sucrose
>250
similar
to
that
of
previously
reported
GNA-like
lectins
(Table
2).
Transcription
and
expression
of
NTL
in
Chinese
Narcissus
Lectins
usually
accumulate
in
storage
tissues
such
as
seeds,
tubers,
bulbs,
corns,
rhizomes
and
roots.
It
is
assumed
that
lectins
are
involved
in
fundamental
biological
processes
in
plants,
such
as
plant
defense,
seed
germination
and
seedling
growth.
RT-PCR
and
western
blotting
were
used
to
study
the
transcription
of
NTL
and
the
accumulation
of
the
translated
protein
in
different
organs
including
roots,
scales,
leaves
and
flowers.
NTL
was
found
to
be
highly
expressed
in
flowers,
leaves
and
roots,
but
more
moderately
in
scales
(Fig.
4).
The
corresponding
protein
was
detected
in
all
four
of
the
examined
organs
by
western
blotting
(Fig.
5),
indicating
that
it
might
play
an
important
role
in
Chinese
narcissus.
Subcellular
localization
of
NTL
The
cellular
distribution
of
NTL
was
studied
by
tran-
siently
expressing
an
NTL—GFP
fusion
in
onion
epider-
mal
cells
using
gold-particle
biolistics.
By
visualization
of
the
fluorescence
within
the
transformed
cells,
it
Supernatant
of
lysate
Purified
protein
Physiol.
Plant.
142,
2011
199
1
2
N
TL
1
BS
rRNA
ammo
Fig.
4.
Narcissus
tazetta
lectin
(NTL)
transcription
in
different
organs
was
analyzed
by
reverse
transcription-polymerase
chain
reaction
(RT-PCR),
using
the
18S
rRNA
as
a
control.
Lane
1:
root;
lane
2:
scale;
lane
3:
leaf
and
lane
4:
flower.
The
amount
of
transcription
of
NTL
and
18S
rRNA
was
checked
after
28
cycles
by
PCR.
The
level
of
NTL
transcription
was
high
in
the
root,
leaf
and
flower,
but
less
so
in
the
scale.
1
IOW
411111110
11111116
Fig.
5.
Analysis
of
Narcissus
tazetta
lectin
(NTL)
accumulation
in
different
organs
by
western
blotting.
Lane
1:
leaf;
lane
2:
root;
lane
3:
scale;
and
lane
4:
flower.
Fifteen
microgram
of
total
proteins
were
loaded
on
each
lane.
The
NTL
protein
was
detected
in
all
four
organs.
was
found
that
the
NTL—GFP
fusion
protein
exhibited
a
punctate
expression
pattern
(Fig.
6A—J).
In
contrast,
cells
transformed
with
the
CaMV35S::GFP
construct
and
expressing
free
GFP
exhibited
a
homogeneous
distribu-
tion
of
fluorescent
material
(Fig.
6K—M).
Discussion
A
full-length
cDNA
of
NTL
was
isolated
from
Chinese
narcissus
and
its
functional
characteristics
were
studied.
Sequence
analysis
and
functional
studies
demonstrated
it
to
be
similar
to
previously
reported
GNA-like
lectins.
The
amino
acid
sequence
of
the
protein
encoded
by
NTL
was
deduced
and
compared
to
the
deduced
sequences
of
NTL1
and
NTA
cloned
from
Chinese
narcissus
in
our
laboratory.
The
homology
between
these
proteins
and
NTL
exceeds
95%
and
all
three
have
three
mannose-binding
sequences
(Q_D_N_V_Y)
and
four
cysteine
residues
in
conserved
positions
(Appendix
S2).
The
four
fixed-position
cysteines
may
form
disulfide-bond
linkages
to
stabilize
the
secondary
structure
of
the
mature
lectin
(Linda
et
al.
2001).
The
three
most
abundant
amino
acids
in
the
three
lectins
are
Glycine,
Leucine
and
Threonine;
together,
these
residues
account
for
more
than
8%
of
the
total
number
of
amino
acids
in
these
proteins.
The
calculated
molecular
weights
of
NTL,
NTL1
and
NTLA
were
18.6,
18.7
and
18.6
kDa
and
the
proteins
were
calculated
to
have
pis
of
5.27,
5.34
and
5.56,
respectively
(Appendix
S3).
Three
man
nose-specific
isolectins
have
previously
been
isolated
from
N.
tazetta;
they
were
designated
NTLx,
NTLy
and
NTLz
(Linda
et
al.
2001).
The
amino
acid
sequences
of
NTLx,
NTLy
and
NTLz
exhibit
96%
identity
with
that
of
NTL;
they
also
incorporate
a
pair
of
cysteine
residues
at
conserved
positions
(C54
and
C77),
which
is
a
notable
characteristic
of
GNA-like
lectins
(or
monocot
MBLs)
(Linda
et
al.
2001).
Plants
typically
produce
a
wide
range
of
isolectins
that
bind
specifically
to
different
carbohydrates
and
fulfill
diverse
physiological
roles
(Rudiger
and
Gabius
2001);
this
is
reflected
in
the
existence
of
NTLx,
NTLy,
NTLz,
NTL,
NTL1
and
NTLA
in
N.
tazetta.
However,
the
exact
physiological
function
of
these
isolectins
in
N.
tazetta
remains
unknown.
To
determine
the
biological
activity
of
NTL,
an
expres-
sion
vector
incorporating
the
NTL
gene
was
constructed
and
transformed
into
E.
coli.
Initially,
NTL
was
cloned
into
pET-23a
for
heterogeneous
expression.
However,
the
great
majority
of
the
recombinant
protein
produced
using
this
construct
precipitated
to
form
inclusion
bodies
and
when
the
transformed
cells
were
lysed
and
cen-
trifuged,
the
supernatant
exhibited
no
hemagglutinating
activity
(data
not
shown).
Efforts
to
increase
the
solubility
of
the
recombinant
protein
by
varying
the
inoculation
time,
temperature
and
IPTG
concentration
all
proved
fruitless.
Consequently,
a
new
NTL
expression
vector
was
constructed
using
GST
as
a
fusion
partner
to
improve
the
solubility
of
the
recombinant
protein
in
E.
coli.
Thus,
NTL
was
cloned
into
the
pGEX-6P-1-H
plasmid
and
used
to
transform
E.
coli
in
order
to
obtain
a
GST—NTL
recombinant
protein.
Significant
levels
of
the
recom-
binant
protein
were
observed
in
the
supernatant
of
the
lysates
of
these
cells
following
inoculation
and
induction
(Fig.
3)
and
both
the
crude
supernatant
and
the
purified
recombinant
protein
exhibited
hemagglutinating
activity
with
trypsin-treated
erythrocytes;
the
hemagglutinating
activity
of
the
crude
supernatant
was
418
HU,
while
that
of
the
purified
fusion
protein
was
265
HU.
Neither
crude
extracts
nor
purified
proteins
from
cells
transformed
with
the
unmodified
pGEX-6P-1-H
plasmid
exhibited
any
hemagglutinating
activity,
indicating
that
the
hemagglu-
tinating
activity
of
the
fusion
protein
is
because
of
NTL.
The
in
vitro
hemagglutination
assay
used
to
measure
the
activity
of
NTL
was
also
used
to
study
the
specificity
of
its
binding
to
and
inhibition
by
carbohydrates.
Of
the
nine
tested
sugars,
only
D-(+)-man
nose
was
found
to
inhibit
NTL-mediated
hemagglutination,
at
sugar
concentrations
ranging
from
62.5
to
250
mM.
Other
sugars
(L-Arabi
nose,
D-Xylose,
D-Galactose,
D-Glucose,
D-Lactose,
D-Maltose,
D-Raffinose,
D-Rhamnose
and
D-Sucrose)
did
not
inhibit
hemagglutination
even
at
a
concentration
of
250
mM.
These
results
indicate
that
NTL
binds
specifically
to
man
nose.
Overall,
the
results
of
the
sequence
analysis,
hemagglutination
assays
and
sugar
inhibition
studies
of
NTL
are
consistent
with
it
200
Physiol.
Plant.
142,
2011
A
103
Isti
4
K
10
310
,1
a
D
103
inti
H
1303m
LS
1
fi
-
1/4
S
err
1.
j
L
I
Fig.
6.
Subcellular
localization
of
green
fluorescent
protein
(GFP)
and
Narcissus
tazetta
lectin
(NTL)—GFP
fusion
proteins
in
living
onion
epidermal
cells.
Onion
epidermal
cells
were
transformed
with
plasmids
expressing
NTL—GFP
(A—J)
or
the
GFP
fusion
protein
(K—M).
A,
D,
H
and
K:
Fluorescence
image;
B,
E,
I
and
L:
bright-field
image
and
C,
F,
J
and
M:
conformity
for
both.
Physiol.
Plant.
142,
2011
201
being
a
GNA-like
lectin.
Future
work
within
our
group
will
focus
on
investigating
its
carbohydrate-binding
specificity
using
glycan
arrays.
Plant
lectins
are
a
widespread
group
of
carbohydrate-
binding
proteins
that
exhibit
a
great
degree
of
hetero-
geneity
in
terms
of
their
biological
activities.
These
differences
in
biological
activity
are
related
to
the
reg-
ulation
of
the
lectins'
temporal
and
spatial
expression.
For
example,
it
is
assumed
that
lectins
found
in
roots
of
some
plants
may
be
involved
in
symbiotic
interactions
between
the
plants
and
microorganisms
(Pueppke
et
al.
1978,
Spilatro
et
al.
1996,
Biswas
et
al.
2009).
However,
lectins
expressed
in
vegetative
tissues
may
be
related
to
plant
defense
and
stress
physiology,
carbohydrate
metabolism
and
the
packaging
of
storage
proteins
(Etzler
1986,
Kijne
et
al.
1986,
Spilatro
et
al.
1996,
Evandro
et
al.
2010).
On
the
basis
of
their
expression
patterns,
plant
lectins
can
be
divided
into
two
groups:
the
highly
expressed
(e.g.
some
storage
proteins)
and
those
whose
expression
is
low
but
inducible,
such
as
the
jasmonate-inducible
lectins
in
tobacco
and
cereals
(Van
Damme
et
al.
1995,
2004,
2008).
Typically,
the
highly
expressed
lectins
are
those
that
are
predominantly
expressed
in
seeds
and/or
vegetative
storage
tissues,
where
they
are
synthesized
with
an
appended
SP
and
targeted
via
the
secretory
pathway
into
the
vacuolar
or
extracellular
compartment.
Inducible
lectins
have
two
characteristic
properties:
(1)
they
are
synthesized
in
response
to
specific
stress
factors
and
(2)
they
are
synthesized
in
the
cytoplasm
and
are
present
in
the
cytoplasmic
and
nuclear
compart-
ments
of
the
cell
(Van
Damme
et
al.
2008).
Generally,
highly
expressed
lectins
are
transcribed
at
a
higher
level
and
can
be
detected
in
many
organs,
suggesting
that
they
play
an
important
role
in
fundamental
physiolog-
ical
processes
such
as
storage
and
defense.
Inducible
lectins
are
usually
expressed
at
a
much
lower
level,
but
once
induced,
they
are
rapidly
transcribed,
resulting
in
a
prompt
physiological
response;
in
some
sense,
they
can
thus
be
viewed
as
signal
molecules.
We
found
that
NTL
was
transcribed
and
translated
at
a
high
level
in
all
four
of
the
organs
examined,
suggesting
that
it
may
be
involved
in
fundamental
physiological
processes.
According
to
Van
Damme
et
al.
(2008),
plant
lectins
can
be
divided
into
two
groups
based
on
their
subcellu-
lar
localization:
vacuolar
plant
lectins
and
'cytoplasmic'
plant
lectins.
Vacuolar
plant
lectins
are
synthesized
on
the
endoplasmic
reticulum
(ER)
and
followed
the
secretory
pathway
to
their
final
destination
into
the
vac-
uolar
compartment,
while
'cytoplasmic'
plant
lectins
are
located
in
the
cytoplasm
and
the
nucleus.
Vacuo-
lar
plant
lectins
are
characterized
by
the
fact
that
they
incorporate
an
SP
at
the
N
terminus,
unlike
the
'cytoplas-
mic'
plant
lectins.
The
predicted
amino
acid
sequence
of
NTL
includes
a
24
as
SP
at
the
N
terminus,
as
observed
in
the
vacuolar
plant
lectins
(Van
Damme
et
al.
2008).
Consequently,
it
is
reasonable
to
suppose
that
NTL
will
be
localized
in
the
vacuole.
Furthermore,
the
presence
of
the
SP
means
that
NTL
is
unlikely
to
be
localized
in
the
cell
membrane
system,
nucleus,
ER,
extracellular
compartment
or
cytoplasm
(Yokoi
et
al.
2002,
Mergaert
et
al.
2003,
Momonoi
et
al.
2009).
According
to
Rudiger,
vacuolar
storage
proteins
are
synthesized
in
the
ER
and
transported
to
the
central
vacuole
via
the
Golgi
appara-
tus
(Rudiger
and
Gabius
2001).
Recently,
the
subcellular
localization
of
GNA
in
tobacco
BY-2
cells
was
studied
by
Fouquaert
et
al.
(2007).
They
transformed
tobacco
BY-2
cells
with
the
entire
coding
sequence
of
GNA,
which
consists
of
a
23
amino
acid
SP,
the
mature
109-residue
polypeptide
and
the
24
amino
acid
CTP
(C-terminal
propeptide);
the
CTP
was
fused
at
its
C
terminus
to
EGFP,
giving
a
final
fusion
protein
with
the
following
structure:
SP-GNA-CTP-EGFP.
It
was
found
that
in
cells
expressing
this
construct,
intense
punctate
EGFP
fluorescence
was
visible
around
the
whole
cell
(Fouquaert
et
al.
2007).
However,
in
BY-2
cells
transformed
with
SP-EGFP-GNA-
CTP
or
SP-EGFP-CTP,
microscopic
analysis
revealed
that
the
localization
pattern
of
the
fluorescent
protein
changed
over
time.
Thus,
shortly
after
transformation,
the
fluorescent
label
was
mainly
concentrated
around
the
nucleus;
later,
a
punctate
staining
pattern
similar
to
that
observed
for
SP-GNA-CTP-EGFP
was
observed;
and
finally,
fluorescence
was
primarily
observed
in
the
cen-
tral
vacuole.
Fouquaert
proposed
that
GNA
might
enter
the
secretory
pathway
and
be
transported
into
the
central
vacuole
via
the
prevacuolar
compartments
(PVCs).
Our
observation
of
an
intense
punctate
staining
pattern
in
onion
cells
transformed
with
NTL—GFP
mirrors
that
of
Fouquaert
et
al.
(2007).
Furthermore,
comparative
ana-
lysis
of
the
predicted
amino
acid
sequences
of
GNA
and
NTL
shows
that
they
exhibit
79%
sequence
identity
over
their
complete
sequences;
the
sequence
identity
of
their
SPs
is
68%,
while
that
of
their
C
terminal
domains
is
75%
(data
not
shown).
Consequently,
it
is
tempting
to
specu-
late
that
NTL
may
be
a
storage
protein
and
would
thus
also
be
synthesized
in
the
ER,
transported
via
the
Golgi
apparatus
and
targeted
to
the
central
vacuole.
However,
the
nature
of
the
punctate
structures
remains
unknown
and
merits
further
study
(Fouquaert
et
al.
2007).
The
subcellular
localization
study
showed
that
NTL
is
presumably
localized
in
the
vacuole
and
analysis
of
its
expression
pattern
demonstrated
that
NTL
is
expressed
at
a
high
level;
both
these
facts
suggest
that
NTL
may
act
as
a
vacuolar
storage
protein
(Figs
4-6).
Many
vacuolar
storage
proteins
such
as
lectins,
protease
inhibitors
and
202
Physiol.
Plant.
142,
2011
ribosome
inactivating
proteins
are
toxic
and
probably
evolved
to
protect
plants
from
predators
(Vitale
and
Hinz
2005).
Pest
damage
has
become
one
of
the
main
factors
influencing
crop
yield.
At
present,
crop
protection
is
primarily
dependent
on
the
use
of
agrochemicals,
especially
insecticides.
However,
exclusive
reliance
on
insecticides
has
resulted
in
environmental
pollution
and
rapid
increases
in
insect
resistance.
Transgenic
technology
offers
an
alternative
to
chemical
pesticides
in
terms
of
pest
control
strategies.
In
light
of
the
growing
demand
for
transgenic
plants,
it
is
increasingly
important
to
identify
genes
involved
in
responding
to
and
mitigating
biotic
and
abiotic
stresses
in
plants.
There
is
a
growing
body
of
evidence
indicating
that
lectins
play
a
role
in
protecting
plants
from
insect
predators,
particularly
in
Amaryllidaceae
species
such
as
G.
nivalis,
Narcissus
pseudonarissus
and
Hippeastrum.
Transgenic
tobacco
and
rice
with
the
gene
encoding
lectin
from
snowdrop
(G.
nivalis)
showed
significantly
increased
insecticidal
activity
toward
peach
potato
aphids
(Rahbe
et
al.
1995)
and
the
brown
planthopper
(Rao
et
al.
1998).
We
have
transformed
Arabidopsis
thaliana
with
NTL
and
are
currently
analyzing
the
effect
of
this
transformation
on
the
plant's
insect
resistance.
Although
great
progress
has
been
made
in
understand-
ing
the
structure
and
function
of
lectins,
little
is
known
about
their
expression
and
accumulation
in
Chinese
nar-
cissus.
The
results
reported
in
this
study
concerning
the
properties
of
NTL,
including
analyses
of
its
nucleotide
and
amino
acid
sequences,
expression
pattern,
localiza-
tion
and
synthesis
of
recombinant
proteins
in
vitro,
repre-
sent
a
significant
increase
in
this
body
of
knowledge
that
will
facilitate
the
further
study
of
GNA-like
lectins
and
may
be
of
use
in
developing
their
practical
applications.
Acknowledgements
This
study
was
financially
supported
under
Project
'948'
by
the
State
Forestry
Administration
of
China
(No.
2006-4-007)
and
by
the
Fundamental
Research
Funds
for
the
Central
Universities
(ZZ1026).
We
are
very
grateful
to
Prof.
Zhang
Yujie
for
her
kind
help
with
the
hemagglutinating
test
and
Prof.
Dong
Yuhui
for
providing
the
pGEX-6P-1-H
plasmid.
References
Beriiter
J,
Feusi
MES
(1997)
The
effect
of
girdling
on
carbohydrate
partitioning
in
the
growing
apple
fruit.
J
Plant
Physiol
151:
277-285
Biswas
S,
Saroha
A,
Das
HR
(2009)
A
lectin
from
Sesbania
aculeata
(Dhaincha)
roots
and
its
possible
function.
Biochem
(Mosc)
74:
329-335
Bravo
A,
Soberon
M
(2008)
How
to
cope
with
insect
resistance
to
Bt
toxins?.
Trends
Biotechnol
26:
573-579
Chen
ZL,
Yu
Y,
Liu
LN,
Xia
GX
(2007)
Isolation,
characterization
and
functional
analysis
of
a
cdc48
homologue
from
tobacco
BY-2
cells.
Prog
Nat
Sci
17:
156-162
Etzler
ME
(1986)
Distribution
and
function
of
plant
lectins.
In:
Liener
1E,
Sharon
N
(eds)
The
Lectins:
Properties,
Functions,
and
Applications
in
Biology
and
Medicine.
Academic
Press,
New
York,
pp
371-435
Evandro
FF,
Wong
JH,
Lin
P,
Ng
TB
(2010)
Biochemical
and
functional
properties
of
a
lectin
purified
from
Korean
large
black
soybeans—a
cultivar
of
Glycine
max.
Protein
Pept
Lett
17:
690-698
Fouquaert
E,
Hanton
SL,
Brandizzi
F,
Peumans
WJ,
Van
Damme
EJM
(2007)
Localization
and
topogenesis
studies
of
cytoplasmic
and
vacuolar
homologs
of
the
Galanthus
nivalis
agglutinin:
linking
molecular
to
functional
evolution
of
a
mannose-binding
domain.
Plant
Cell
Physiol
48:
1010-1021
Jiang
SY,
Ma
ZG,
Ramachandran
S
(2010)
Evolutionary
history
and
stress
regulation
of
the
lectin
superfamily
in
higher
plants.
BMC
Evol
Biol
10:
79
Jouanin
L,
Bonade-Bottino
M,
Girard
C,
Morrot
G,
Giband
M
(1998)
Transgenic
plants
for
insect
resistance.
Plant
Sci
131:1-11
Kijne
JW,
Dfaz
CL,
Bakhuizen
R
(1986)
The
physiological
function
of
lectins.
In.
In:
Bsg-Hanson
TC,
van
Driessche
E
(eds)
Lectins:
Biology,
Biochemistry,
Clinical
Biochemistry,
Vol.
5.
Walter
de
Gruyter,
Berlin,
pp
45-52
Liener
LE
(1955)
The
photometric
determination
of
the
hemagglutinating
activity
of
soyin
and
crude
soybean
extracts.
Arch
Biochem
Biophys
54:
223-231
Linda
SMO,
Wang
HX,
Ng
TB,
Vincent
ECO
(1998)
Isolation
and
characterization
of
a
mannose-binding
lectin
from
leaves
of
the
Chinese
daffodil
Narcissus
tazetta.
Biochem
Cell
Biol
76:
601-608
Linda
SMO,
Ng
TB,
Geng
Y,
Ooi
VE
(2000a)
Lectins
from
bulbs
of
the
Chinese
daffodil
Narcissus
tazetta
(family
Amaryllidaceae).
Biochem
Cell
Biol
78:
463-468
Linda
SMO,
Ng
TB,
Sun
SSM,
Vincent
ECO
(2000b)
Mannose-specific
isolectins
with
different
hemagglutinating
potencies
isolated
from
Chinese
Daffodil
(Narcissus
tazetta
var.
chinensis)
leaves.
J
Protein
Chem
19:
163-168
Linda
SMO,
Sun
MSS,
Ng
TB,
Ooi
VEC
(2001)
Molecular
cloning
and
the
cDNA-derived
amino
acid
sequence
of
Narcissus
tazetta
Isolectins.
J
Protein
Chem
20:
305-310
Linda
SMO,
Wing-Shan
H,
Karry
LKN,
Li
T,
Paul
KSC,
Samuel
SMS,
Sun
SSM,
Vincent
ECO
(2010)
Narcissus
tazetta
lectin
shows
strong
inhibitory
effects
against
respiratory
syncytial
virus,
influenza
A
(H1
N1,
H3N2,
H5N1)
and
B
viruses.
J
Biosci
35:
95-103
Liu
WF,
Hou
CG,
Gao
J,
Shen
X
(2009)
Cloning
and
sequence
analysis
of
the
lectin
ortholog
NTA
from
Chinese
Narcissus
(Narcissus
tazetta
var.
Chinensis
Physiol.
Plant.
142,
2011
203
Roem)
and
structure
prediction
of
the
protein.
(in
Chinese
with
English
abstract)
Genomics
Appl
Biol
28:
216-222
Mergaert
P,
Nikovics
K,
Kelemen
Z,
Maunoury
N,
Vaubert
D,
Kondorosi
A,
Kondorosi
E
(2003)
A
novel
family
in
Medicago
truncatula
consisting
of
more
than
300
nodule-specific
genes
coding
for
small,
secreted
polypeptides
with
conserved
cysteine
motifs.
Plant
Physiol
132:
161-173
Momonoi
K,
Yoshida
K,
Mano
S,
Takahashi
H,
Nakamori
C,
Shoji
K,
Nitta
A,
Nishimura
M
(2009)
A
vacuolar
iron
transporter
in
tulip,
TgVit1,
is
responsible
for
blue
coloration
in
petal
cells
through
iron
accumulation.
Plant
J
59:
437-447
Pang
Y,
Shen
G,
Qi
H,
Tan
F,
Sun
X,
Tang
K
(2004)
Transgenic
tobacco
expressing
Zephyranthes
candida
agglutinin
showing
enhanced
resistance
to
aphids.
Eng
Life
Sci
4:
155-159
Pueppke
SG,
Bauer
WD,
Keegstra
K,
Ferguson
AL
(1978)
Role
of
lectins
in
plant-microorganism
interactions
II:
distribution
of
soybean
lectin
in
tissues
of
Glycine
max
(L.)
Merr.
Plant
Physiol
61:
779-784
Rahbe
Y,
Sauvion
N,
Febvay
G,
Peumans
WJ,
Gatehouse
AMR
(1995)
Toxicity
of
lectins
and
processing
of
ingested
proteins
in
the
pea
aphid
Acyrthosiphon
pisum.
Entomol
Exp
Appl
76:
143-155
Rao
KV,
Rathore
KS,
Hodges
TK
(1998)
Expression
of
snowdrop
lectin
(GNA)
in
transgenic
rice
plants
confers
resistance
to
rice
brown
planthopper.
Plant
J
15:
469-477
Rudiger
H,
Gabius
FIJ
(2001)
Plant
lectins:
occurrence,
biochemistry,
functions
and
applications.
Glycoconj
J
18:
589-613
Sambrook
J,
Fritsch
EF,
Maniatis
T
(1989)
Molecular
Cloning—A
Laboratory
Manual,
2nd
Edn.
Cold
Spring
Harbor
Lab.
Press,
New
York
Spilatro
SR,
Cochran
GR,
Walker
RE,
Cablish
KL,
Bittner
CC
(1996)
Characterization
of
a
new
lectin
of
soybean
vegetative
tissues.
Plant
Physiol
110:
825-834
Tamura
K,
Dudley
J,
Nei
M,
Kumar
S
(2007)
MEGA4:
molecular
evolutionary
genetics
analysis
(MEGA)
software
version
4.0.
Mole
Biol
Evol
24:
1596-1599
Turner
RH,
Liener
LE
(1975)
The
use
of
glutaraldehyde-treated
erythrocytes
for
assaying
the
agglutinating
activity
of
lectins.
Anal
Biochem
68:
651-665
Van
Damme
EJM,
Allen
AK,
Peumans
WJ
(1987)
Isolation
and
characterization
of
a
lectin
with
exclusive
specificity
towards
mannose
from
snowdrop
(Galanthus
nivalis)
bulbs.
FEBS
Lett
215:
140-144
Van
Damme
EJM,
Smeets
K,
Peumanns
WJ
(1995)
The
mannose-binding
monocot
lectins
and
their
genes.
In:
Pusztai
A,
Bardocz
S
(eds)
Lectins:
Biomedical
Edited
by
H.
Brumer
Perspectives.
Taylor
and
Francis,
London,
pp
59-80
Van
Damme
EJM,
Peumans
WJ,
Barre
A,
Rouge
P
(1998)
Plant
lectins:
a
composite
of
several
distinct
families
of
structurally
and
evolutionary
related
proteins
with
diverse
biological
roles.
Crit
Rev
Plant
Sci
17:
575-692
Van
Damme
EJM,
Barre
A,
Rouge
P,
Peumans
WJ
(2004)
Cytoplasmic/nuclear
plant
lectins:
a
new
story.
Trends
Plant
Sci
9:
484-489
Van
Damme
EJM,
Lannoo
N,
Peumans
WJ
(2008)
Plant
lectins.
Adv
Bot
Res
48:
107-209
Vitale
A,
Hinz
G
(2005)
Sorting
of
proteins
to
storage
vacuoles:
how
many
mechanisms?.
Trends
Plant
Sci
10:
316-323
Witvrouw
M,
Fikkert
V,
Hantson
A,
Pannecouque
C,
O'keefe
BR,
McMahon
J,
Stamatatos
L,
de
Clercq
E,
Bolmstedt
A
(2005)
Resistance
of
human
immunodeficiency
virus
type
1
to
the
high-mannose
binding
agents
cyanovirin
N
and
concanaval
in
A.
J
Virol
79:
7777-7784
Yokoi
S,
Quintero
FJ,
Cubero
B,
Ruiz
MT,
Bressan
RA,
Hasegawa
PM,
Pardo
JM
(2002)
Differential
expression
and
function
of
Arabidopsis
thaliana
NHX
Na±/H+
antiporters
in
the
salt
stress
response.
Plant
J
30:
529-539
Yu
XQ,
Chen
DF
(2009)
Molecular
cloning
of
a
lectin
gene
from
Narcissus
tazetta
var.
chinensis
and
characteristic
prediction.
(in
Chinese
with
English
abstract)
Acta
Agri
Boreall-Sinica
24:
47-50
Supporting
Information
Additional
Supporting
Information
may
be
found
in
the
online
version
of
this
article:
Appendix
Si.
Result
of
Blastp
experiments,
NTL
and
the
lectins
in
NCBI
database
shared
the
conserved
domains
of
mannose-binding
domain
(Q_D_N_V_Y)
marked
by
rectangle.
Appendix
S2.
Comparison
of
the
deduced
amino
acid
sequences
of
NTL,
NTL1
(Liu
et
al.
2009)
and
NTA
(Yu
et
al.
2009).
Cysteine
sites
are
indicated
by
inverted
triangles;
conserved
D-(+)-mannose-binding
sites
are
highlighted
with
rectangular
boxes.
Appendix
S3.
Comparison
of
the
amino
acid
composi-
tions
and
molecular
weights
of
NTL,
NTL1
and
NTA.
Please
note:
Wiley-Blackwell
are
not
responsible
for
the
content
or
functionality
of
any
supporting
materials
supplied
by
the
authors.
Any
queries
(other
than
missing
material)
should
be
directed
to
the
corresponding
author
for
the
article.
204
Physiol.
Plant.
142,
2011